EMAIL THIS PAGE TO A FRIEND

PHKG2

phosphorylase kinase, gamma 2 (testis)

105 Gene Product Result for
Synonyms: GSD9C
UniProtKB ID: P15735, A8K0C7, B4DEB7, E9PEU3, P11800
Gene ID:
Human(5261) Summary: Phosphorylase kinase is a polymer of 16 subunits, four each of alpha, beta, gamma and delta. The alpha subunit includes the skeletal muscle and hepatic isoforms, encoded by two different genes. The beta subunit is the same in both the muscle and hepatic isoforms, and encoded by one gene. The gamma subunit also includes the skeletal muscle and hepatic isoforms, and the hepatic isoform is encoded by this gene. The delta subunit is a calmodulin and can be encoded by three different genes. The gamma subunits contain the active site of the enzyme, whereas the alpha and beta subunits have regulatory functions controlled by phosphorylation. The delta subunit mediates the dependence of the enzyme on calcium concentration. Mutations in this gene cause glycogen storage disease type 9C, also known as autosomal liver glycogenosis. Alternatively spliced transcript variants encoding different isoforms have been identified in this gene.[provided by RefSeq, Feb 2010]
Mouse(68961) phosphorylase kinase, gamma 2 (testis)
Rat(140671) phosphorylase kinase, gamma 2 (testis)
Zebrafish(393937) phosphorylase kinase, gamma 2 (testis)
dog(607275) phosphorylase kinase, gamma 2 (testis)
Horse(100065274) phosphorylase kinase, gamma 2 (testis)
domestic cat(101092572) phosphorylase kinase, gamma 2 (testis)
cow(512670) phosphorylase kinase, gamma 2 (testis)
Goat(100861337) phosphorylase kinase, gamma 2 (testis)
sheep(100217403) phosphorylase kinase, gamma 2 (testis)
Domestic Rabbit(100355661) phosphorylase kinase, gamma 2 (testis)
naked mole-rat(101700591) phosphorylase kinase, gamma 2 (testis)
domestic guinea pig(100714336) phosphorylase kinase, gamma 2 (testis)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000294 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000294 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000294 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026888 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026888 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026888 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000294 Rosetta Predictions human pricing
NM_080584 Rosetta Predictions rat pricing
NM_026888 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000294 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00086550 predicted 208
2 SASI_Hs02_00302267 predicted 429
3 SASI_Hs01_00086551 predicted 371
4 SASI_Hs01_00086552 predicted 1102
5 SASI_Hs01_00086553 predicted 632
6 SASI_Hs01_00086554 predicted 797
7 SASI_Hs01_00086555 predicted 1061
8 SASI_Hs02_00302268 predicted 1087
9 SASI_Hs01_00086557 predicted 713
10 SASI_Hs01_00086559 predicted 860
11 SASI_Hs01_00086556 predicted 451
12 SASI_Hs01_00086558 predicted 1351
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080584 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00110324 predicted 1068
2 SASI_Rn01_00110325 predicted 479
3 SASI_Rn01_00110326 predicted 723
4 SASI_Rn01_00110327 predicted 1298
5 SASI_Rn02_00267258 predicted 677
6 SASI_Rn01_00110328 predicted 1078
7 SASI_Rn01_00110329 predicted 655
8 SASI_Rn01_00110330 predicted 803
9 SASI_Rn01_00110331 predicted 1318
10 SASI_Rn01_00110333 predicted 1131
11 SASI_Rn01_00110332 predicted 436
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026888 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00077275 predicted 1082
2 SASI_Mm01_00077276 predicted 504
3 SASI_Mm01_00077277 predicted 865
4 SASI_Mm01_00077278 predicted 441
5 SASI_Mm01_00077280 predicted 1107
6 SASI_Mm01_00077281 predicted 1099
7 SASI_Mm01_00077282 predicted 1100
8 SASI_Mm01_00077283 predicted 790
9 SASI_Mm02_00331150 predicted 875
10 SASI_Mm01_00077284 predicted 1083
11 SASI_Mm01_00077279 predicted 570
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000294
VALIDATED
PHKG2 MISSION shRNA Bacterial Glycerol Stock
phosphorylase kinase, gamma 2 (testis)
Human
27 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000368394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000294.1-690s21c1
Sequence:CCGGTAAATGCTCCATGGATGAAACCTCGAGGTTTCATCCATGGAGCATTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000294.1-1163s21c1
Sequence:CCGGTCTACGGGCACTGGGTAAAGACTCGAGTCTTTACCCAGTGCCCGTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355711    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000294.1-1327s21c1
Sequence:CCGGAGGGATTCCCAGGAAGCAGAACTCGAGTTCTGCTTCCTGGGAATCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000294.1-633s21c1
Sequence:CCGGTGGCGAGAAGCTTCGAGAGTTCTCGAGAACTCTCGAAGCTTCTCGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195601    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000294.1-1345s1c1
Sequence:CCGGGAACTCTCCAGAAGAAGGGTTCTCGAGAACCCTTCTTCTGGAGAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_000294.1-435s1c1
Sequence:CCGGGCTGTTTGACTATCTCACAGACTCGAGTCTGTGAGATAGTCAAACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_000294.1-548s1c1
Sequence:CCGGGAGATCTGAAGCCCGAGAATACTCGAGTATTCTCGGGCTTCAGATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000294.1-233s1c1
Sequence:CCGGGCCACGAGTTTGCGGTGAAGACTCGAGTCTTCACCGCAAACTCGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000294.1-1263s21c1
Sequence:CCGGGGGAGACTCTGCTGCTATAACCTCGAGGTTATAGCAGCAGAGTCTCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_000294.1-869s21c1
Sequence:CCGGACCGTTCCAGCACTGTCAAAGCTCGAGCTTTGACAGTGCTGGAACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000294.1-674s21c1
Sequence:CCGGTAGCGCCAGAGATCCTTAAATCTCGAGATTTAAGGATCTCTGGCGCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_000294.1-582s21c1
Sequence:CCGGCAATATGCAGATCCGACTTTCCTCGAGGAAAGTCGGATCTGCATATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231471    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_000294.1-1401s21c1
Sequence:CCGGGCCCACTAATGATCCTGCTACCTCGAGGTAGCAGGATCATTAGTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000294.1-567s21c1
Sequence:CCGGTATTCTCCTAGATGACAATATCTCGAGATATTGTCATCTAGGAGAATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199891    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_000294.1-1417s1c1
Sequence:CCGGGCTACCCTCTTGAAGACCAGCCTCGAGGCTGGTCTTCAAGAGGGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_000294.x-673s1c2
Sequence:CCGGCTAGCGCCAGAGATCCTTAAACTCGAGTTTAAGGATCTCTGGCGCTAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_000294.1-635s1c1
Sequence:CCGGGCGAGAAGCTTCGAGAGTTGTCTCGAGACAACTCTCGAAGCTTCTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_000294.x-1078s1c1
Sequence:CCGGCGGCCACTGACCAAGAATGCACTCGAGTGCATTCTTGGTCAGTGGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_000294.x-580s1c1
Sequence:CCGGGACAATATGCAGATCCGACTTCTCGAGAAGTCGGATCTGCATATTGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355683    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000294.1-1339s21c1
Sequence:CCGGGAAGCAGAACTCTCCAGAAGACTCGAGTCTTCTGGAGAGTTCTGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000294.1-1076s21c1
Sequence:CCGGTACGGCCACTGACCAAGAATGCTCGAGCATTCTTGGTCAGTGGCCGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_000294.x-677s1c1
Sequence:CCGGCGCCAGAGATCCTTAAATGCTCTCGAGAGCATTTAAGGATCTCTGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_000294.x-211s1c1
Sequence:CCGGCGTTGTGTTCATCGAGCTACTCTCGAGAGTAGCTCGATGAACACAACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000294.x-1270s1c1
Sequence:CCGGTCTGCTGCTATAACTGAGGATCTCGAGATCCTCAGTTATAGCAGCAGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000398    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_000294.x-1406s1c1
Sequence:CCGGCTAATGATCCTGCTACCCTCTCTCGAGAGAGGGTAGCAGGATCATTAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_000294.x-702s1c1
Sequence:CCGGGGATGAAACCCACCCAGGCTACTCGAGTAGCCTGGGTGGGTTTCATCCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_000294.x-673s1c1
Sequence:CCGGCTAGCGCCAGAGATCCTTAAACTCGAGTTTAAGGATCTCTGGCGCTAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000294
VALIDATED
PHKG2 MISSION shRNA shRNA Plasmid DNA
phosphorylase kinase, gamma 2 (testis)
Human
27 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000368394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000294.1-690s21c1
Sequence:CCGGTAAATGCTCCATGGATGAAACCTCGAGGTTTCATCCATGGAGCATTTATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000368340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000294.1-1163s21c1
Sequence:CCGGTCTACGGGCACTGGGTAAAGACTCGAGTCTTTACCCAGTGCCCGTAGATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000355711    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000294.1-1327s21c1
Sequence:CCGGAGGGATTCCCAGGAAGCAGAACTCGAGTTCTGCTTCCTGGGAATCCCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000355685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000294.1-633s21c1
Sequence:CCGGTGGCGAGAAGCTTCGAGAGTTCTCGAGAACTCTCGAAGCTTCTCGCCATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000195601    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000294.1-1345s1c1
Sequence:CCGGGAACTCTCCAGAAGAAGGGTTCTCGAGAACCCTTCTTCTGGAGAGTTCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000196825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_000294.1-435s1c1
Sequence:CCGGGCTGTTTGACTATCTCACAGACTCGAGTCTGTGAGATAGTCAAACAGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000196908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_000294.1-548s1c1
Sequence:CCGGGAGATCTGAAGCCCGAGAATACTCGAGTATTCTCGGGCTTCAGATCTCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000199904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000294.1-233s1c1
Sequence:CCGGGCCACGAGTTTGCGGTGAAGACTCGAGTCTTCACCGCAAACTCGTGGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000231470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000294.1-1263s21c1
Sequence:CCGGGGGAGACTCTGCTGCTATAACCTCGAGGTTATAGCAGCAGAGTCTCCCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000231469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_000294.1-869s21c1
Sequence:CCGGACCGTTCCAGCACTGTCAAAGCTCGAGCTTTGACAGTGCTGGAACGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000231468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000294.1-674s21c1
Sequence:CCGGTAGCGCCAGAGATCCTTAAATCTCGAGATTTAAGGATCTCTGGCGCTATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000231467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_000294.1-582s21c1
Sequence:CCGGCAATATGCAGATCCGACTTTCCTCGAGGAAAGTCGGATCTGCATATTGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000231471    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_000294.1-1401s21c1
Sequence:CCGGGCCCACTAATGATCCTGCTACCTCGAGGTAGCAGGATCATTAGTGGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000355684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000294.1-567s21c1
Sequence:CCGGTATTCTCCTAGATGACAATATCTCGAGATATTGTCATCTAGGAGAATATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000199891    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_000294.1-1417s1c1
Sequence:CCGGGCTACCCTCTTGAAGACCAGCCTCGAGGCTGGTCTTCAAGAGGGTAGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000055433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_000294.x-673s1c2
Sequence:CCGGCTAGCGCCAGAGATCCTTAAACTCGAGTTTAAGGATCTCTGGCGCTAGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000199678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_000294.1-635s1c1
Sequence:CCGGGCGAGAAGCTTCGAGAGTTGTCTCGAGACAACTCTCGAAGCTTCTCGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000010056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_000294.x-1078s1c1
Sequence:CCGGCGGCCACTGACCAAGAATGCACTCGAGTGCATTCTTGGTCAGTGGCCGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000010065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_000294.x-580s1c1
Sequence:CCGGGACAATATGCAGATCCGACTTCTCGAGAAGTCGGATCTGCATATTGTCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000355683    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000294.1-1339s21c1
Sequence:CCGGGAAGCAGAACTCTCCAGAAGACTCGAGTCTTCTGGAGAGTTCTGCTTCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000368313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000294.1-1076s21c1
Sequence:CCGGTACGGCCACTGACCAAGAATGCTCGAGCATTCTTGGTCAGTGGCCGTATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000000401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_000294.x-677s1c1
Sequence:CCGGCGCCAGAGATCCTTAAATGCTCTCGAGAGCATTTAAGGATCTCTGGCGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000000400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_000294.x-211s1c1
Sequence:CCGGCGTTGTGTTCATCGAGCTACTCTCGAGAGTAGCTCGATGAACACAACGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000000399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000294.x-1270s1c1
Sequence:CCGGTCTGCTGCTATAACTGAGGATCTCGAGATCCTCAGTTATAGCAGCAGATTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000000398    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_000294.x-1406s1c1
Sequence:CCGGCTAATGATCCTGCTACCCTCTCTCGAGAGAGGGTAGCAGGATCATTAGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000010069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_000294.x-702s1c1
Sequence:CCGGGGATGAAACCCACCCAGGCTACTCGAGTAGCCTGGGTGGGTTTCATCCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000010068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_000294.x-673s1c1
Sequence:CCGGCTAGCGCCAGAGATCCTTAAACTCGAGTTTAAGGATCTCTGGCGCTAGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000294
VALIDATED
PHKG2 MISSION shRNA Lentiviral Transduction Particles
phosphorylase kinase, gamma 2 (testis)
Human
27 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000368394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000294.1-690s21c1
Sequence:CCGGTAAATGCTCCATGGATGAAACCTCGAGGTTTCATCCATGGAGCATTTATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000368340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000294.1-1163s21c1
Sequence:CCGGTCTACGGGCACTGGGTAAAGACTCGAGTCTTTACCCAGTGCCCGTAGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355711    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000294.1-1327s21c1
Sequence:CCGGAGGGATTCCCAGGAAGCAGAACTCGAGTTCTGCTTCCTGGGAATCCCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000294.1-633s21c1
Sequence:CCGGTGGCGAGAAGCTTCGAGAGTTCTCGAGAACTCTCGAAGCTTCTCGCCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195601    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000294.1-1345s1c1
Sequence:CCGGGAACTCTCCAGAAGAAGGGTTCTCGAGAACCCTTCTTCTGGAGAGTTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_000294.1-435s1c1
Sequence:CCGGGCTGTTTGACTATCTCACAGACTCGAGTCTGTGAGATAGTCAAACAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_000294.1-548s1c1
Sequence:CCGGGAGATCTGAAGCCCGAGAATACTCGAGTATTCTCGGGCTTCAGATCTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000294.1-233s1c1
Sequence:CCGGGCCACGAGTTTGCGGTGAAGACTCGAGTCTTCACCGCAAACTCGTGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000294.1-1263s21c1
Sequence:CCGGGGGAGACTCTGCTGCTATAACCTCGAGGTTATAGCAGCAGAGTCTCCCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_000294.1-869s21c1
Sequence:CCGGACCGTTCCAGCACTGTCAAAGCTCGAGCTTTGACAGTGCTGGAACGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000294.1-674s21c1
Sequence:CCGGTAGCGCCAGAGATCCTTAAATCTCGAGATTTAAGGATCTCTGGCGCTATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_000294.1-582s21c1
Sequence:CCGGCAATATGCAGATCCGACTTTCCTCGAGGAAAGTCGGATCTGCATATTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231471    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_000294.1-1401s21c1
Sequence:CCGGGCCCACTAATGATCCTGCTACCTCGAGGTAGCAGGATCATTAGTGGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000294.1-567s21c1
Sequence:CCGGTATTCTCCTAGATGACAATATCTCGAGATATTGTCATCTAGGAGAATATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199891    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_000294.1-1417s1c1
Sequence:CCGGGCTACCCTCTTGAAGACCAGCCTCGAGGCTGGTCTTCAAGAGGGTAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_000294.x-673s1c2
Sequence:CCGGCTAGCGCCAGAGATCCTTAAACTCGAGTTTAAGGATCTCTGGCGCTAGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_000294.1-635s1c1
Sequence:CCGGGCGAGAAGCTTCGAGAGTTGTCTCGAGACAACTCTCGAAGCTTCTCGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_000294.x-1078s1c1
Sequence:CCGGCGGCCACTGACCAAGAATGCACTCGAGTGCATTCTTGGTCAGTGGCCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_000294.x-580s1c1
Sequence:CCGGGACAATATGCAGATCCGACTTCTCGAGAAGTCGGATCTGCATATTGTCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355683    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000294.1-1339s21c1
Sequence:CCGGGAAGCAGAACTCTCCAGAAGACTCGAGTCTTCTGGAGAGTTCTGCTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000368313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000294.1-1076s21c1
Sequence:CCGGTACGGCCACTGACCAAGAATGCTCGAGCATTCTTGGTCAGTGGCCGTATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_000294.x-677s1c1
Sequence:CCGGCGCCAGAGATCCTTAAATGCTCTCGAGAGCATTTAAGGATCTCTGGCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_000294.x-211s1c1
Sequence:CCGGCGTTGTGTTCATCGAGCTACTCTCGAGAGTAGCTCGATGAACACAACGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000294.x-1270s1c1
Sequence:CCGGTCTGCTGCTATAACTGAGGATCTCGAGATCCTCAGTTATAGCAGCAGATTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000398    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_000294.x-1406s1c1
Sequence:CCGGCTAATGATCCTGCTACCCTCTCTCGAGAGAGGGTAGCAGGATCATTAGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_000294.x-702s1c1
Sequence:CCGGGGATGAAACCCACCCAGGCTACTCGAGTAGCCTGGGTGGGTTTCATCCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_000294.x-673s1c1
Sequence:CCGGCTAGCGCCAGAGATCCTTAAACTCGAGTTTAAGGATCTCTGGCGCTAGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026888
VALIDATED
PHKG2 MISSION shRNA Bacterial Glycerol Stock
phosphorylase kinase, gamma 2 (testis)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000321721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026888.3-418s21c1
Sequence:CCGGCGAGTCTTCTAGCTTCATGTTCTCGAGAACATGAAGCTAGAAGACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026888.3-198s21c1
Sequence:CCGGACGACCCTAAGGACATCATTGCTCGAGCAATGATGTCCTTAGGGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026888.3-903s21c1
Sequence:CCGGATCGTTCAAACACCGTCAAAGCTCGAGCTTTGACGGTGTTTGAACGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026888.3-350s21c1
Sequence:CCGGCGGCGAGAGATGCACATTCTTCTCGAGAAGAATGTGCATCTCTCGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_026888.1-363s1c1
Sequence:CCGGCGAGTCTTCTAGCTTCATGTTCTCGAGAACATGAAGCTAGAAGACTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_026888.1-295s1c1
Sequence:CCGGCGGCGAGAGATGCACATTCTTCTCGAGAAGAATGTGCATCTCTCGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_026888.1-783s1c1
Sequence:CCGGCCAAATCCTGATGCTACGCATCTCGAGATGCGTAGCATCAGGATTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_026888.1-1060s1c1
Sequence:CCGGCCACTAACTAAGAATGCACTACTCGAGTAGTGCATTCTTAGTTAGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_026888.1-552s1c1
Sequence:CCGGCCTAGATGACAATATGCAGATCTCGAGATCTGCATATTGTCATCTAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321722    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026888.3-1378s21c1
Sequence:CCGGGGACTCTCCAGGAGGACATTTCTCGAGAAATGTCCTCCTGGAGAGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026888
VALIDATED
PHKG2 MISSION shRNA shRNA Plasmid DNA
phosphorylase kinase, gamma 2 (testis)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000321721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026888.3-418s21c1
Sequence:CCGGCGAGTCTTCTAGCTTCATGTTCTCGAGAACATGAAGCTAGAAGACTCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000321656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026888.3-198s21c1
Sequence:CCGGACGACCCTAAGGACATCATTGCTCGAGCAATGATGTCCTTAGGGTCGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000321724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026888.3-903s21c1
Sequence:CCGGATCGTTCAAACACCGTCAAAGCTCGAGCTTTGACGGTGTTTGAACGATTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000321720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026888.3-350s21c1
Sequence:CCGGCGGCGAGAGATGCACATTCTTCTCGAGAAGAATGTGCATCTCTCGCCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000024369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_026888.1-363s1c1
Sequence:CCGGCGAGTCTTCTAGCTTCATGTTCTCGAGAACATGAAGCTAGAAGACTCGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000024373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_026888.1-295s1c1
Sequence:CCGGCGGCGAGAGATGCACATTCTTCTCGAGAAGAATGTGCATCTCTCGCCGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000024372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_026888.1-783s1c1
Sequence:CCGGCCAAATCCTGATGCTACGCATCTCGAGATGCGTAGCATCAGGATTTGGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000024370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_026888.1-1060s1c1
Sequence:CCGGCCACTAACTAAGAATGCACTACTCGAGTAGTGCATTCTTAGTTAGTGGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000024371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_026888.1-552s1c1
Sequence:CCGGCCTAGATGACAATATGCAGATCTCGAGATCTGCATATTGTCATCTAGGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000321722    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026888.3-1378s21c1
Sequence:CCGGGGACTCTCCAGGAGGACATTTCTCGAGAAATGTCCTCCTGGAGAGTCCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026888
VALIDATED
PHKG2 MISSION shRNA Lentiviral Transduction Particles
phosphorylase kinase, gamma 2 (testis)
Mouse
10 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000321721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026888.3-418s21c1
Sequence:CCGGCGAGTCTTCTAGCTTCATGTTCTCGAGAACATGAAGCTAGAAGACTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026888.3-198s21c1
Sequence:CCGGACGACCCTAAGGACATCATTGCTCGAGCAATGATGTCCTTAGGGTCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026888.3-903s21c1
Sequence:CCGGATCGTTCAAACACCGTCAAAGCTCGAGCTTTGACGGTGTTTGAACGATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026888.3-350s21c1
Sequence:CCGGCGGCGAGAGATGCACATTCTTCTCGAGAAGAATGTGCATCTCTCGCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_026888.1-363s1c1
Sequence:CCGGCGAGTCTTCTAGCTTCATGTTCTCGAGAACATGAAGCTAGAAGACTCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_026888.1-295s1c1
Sequence:CCGGCGGCGAGAGATGCACATTCTTCTCGAGAAGAATGTGCATCTCTCGCCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_026888.1-783s1c1
Sequence:CCGGCCAAATCCTGATGCTACGCATCTCGAGATGCGTAGCATCAGGATTTGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_026888.1-1060s1c1
Sequence:CCGGCCACTAACTAAGAATGCACTACTCGAGTAGTGCATTCTTAGTTAGTGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_026888.1-552s1c1
Sequence:CCGGCCTAGATGACAATATGCAGATCTCGAGATCTGCATATTGTCATCTAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321722    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026888.3-1378s21c1
Sequence:CCGGGGACTCTCCAGGAGGACATTTCTCGAGAAATGTCCTCCTGGAGAGTCCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)