EMAIL THIS PAGE TO A FRIEND

PHLDA1

pleckstrin homology-like domain, family A, member 1

157 Gene Product Result for
Synonyms: DT1P1B11 PHRIP TDAG51
UniProtKB ID: Q8WV24, A1A4G9, Q15184, Q2TAN2, Q9NZ17
Gene ID:
Human(22822) Summary: This gene encodes an evolutionarily conserved proline-histidine rich nuclear protein. The encoded protein may play an important role in the anti-apoptotic effects of insulin-like growth factor-1. [provided by RefSeq, Jul 2008]
Mouse(21664) pleckstrin homology-like domain, family A, member 1
Rat(29380) pleckstrin homology-like domain, family A, member 1
cow(540135) pleckstrin homology-like domain, family A, member 1
sheep(101102304) pleckstrin homology-like domain, family A, member 1
domestic guinea pig(100723018) pleckstrin homology-like domain, family A, member 1
naked mole-rat(101709470) pleckstrin homology-like domain, family A, member 1
Zebrafish(449990) pleckstrin homology-like domain, family A, member 1
domestic cat(101083351) pleckstrin homology-like domain, family A, member 1
dog(611312) pleckstrin homology-like domain, family A, member 1
Gene Class: Apoptosis
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009344 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009344 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009344 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_007350 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007350 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007350 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007350 Rosetta Predictions human pricing
NM_017180 Rosetta Predictions rat pricing
NM_009344 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007350 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00161315 predicted 1738
2 SASI_Hs01_00161316 predicted 1291
3 SASI_Hs01_00161317 predicted 1429
4 SASI_Hs01_00161318 predicted 1479
5 SASI_Hs02_00343443 predicted 1427
6 SASI_Hs01_00161319 predicted 1463
7 SASI_Hs01_00161320 predicted 727
8 SASI_Hs01_00161321 predicted 1356
9 SASI_Hs02_00343444 predicted 1711
10 SASI_Hs01_00161323 predicted 1379
11 SASI_Hs01_00161322 predicted 756
12 SASI_Hs01_00161324 predicted 1367
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017180 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00103210 predicted 1250
2 SASI_Rn01_00103211 predicted 1248
3 SASI_Rn01_00103213 predicted 640
4 SASI_Rn01_00103214 predicted 824
5 SASI_Rn01_00103215 predicted 707
6 SASI_Rn01_00103216 predicted 1247
7 SASI_Rn01_00103217 predicted 502
8 SASI_Rn01_00103218 predicted 642
9 SASI_Rn01_00103219 predicted 1317
10 SASI_Rn02_00261514 predicted 1310
11 SASI_Rn01_00103212 predicted 803
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009344 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00089911 predicted 1572
2 SASI_Mm01_00089912 predicted 1378
3 SASI_Mm01_00089913 predicted 836
4 SASI_Mm01_00089914 predicted 928
5 SASI_Mm01_00089915 predicted 1380
6 SASI_Mm01_00089916 predicted 578
7 SASI_Mm01_00089917 predicted 1486
8 SASI_Mm01_00089918 predicted 1460
9 SASI_Mm01_00089919 predicted 1567
10 SASI_Mm01_00089920 predicted 1505
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009344
VALIDATED
PHLDA1 MISSION shRNA Bacterial Glycerol Stock
pleckstrin homology-like domain, family A, member 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000312225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009344.3-920s21c1
Sequence:CCGGCGCCGAGATCACGTTGCAGATCTCGAGATCTGCAACGTGATCTCGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009344.3-964s21c1
Sequence:CCGGCCATACTGGCGGTCAAGTCTACTCGAGTAGACTTGACCGCCAGTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009344.1-873s1c1
Sequence:CCGGGAGGGCAAAGAGATCGACTTTCTCGAGAAAGTCGATCTCTTTGCCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009344.1-662s1c1
Sequence:CCGGGCTACTGCTCATACCGCCCAACTCGAGTTGGGCGGTATGAGCAGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009344.1-920s1c1
Sequence:CCGGCGCCGAGATCACGTTGCAGATCTCGAGATCTGCAACGTGATCTCGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009344.1-1168s1c1
Sequence:CCGGCGCATCCGCATCCTCATCCTTCTCGAGAAGGATGAGGATGCGGATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009344.1-774s1c1
Sequence:CCGGCCACCAGTCAAGCTGAAGGAACTCGAGTTCCTTCAGCTTGACTGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009344.3-832s21c1
Sequence:CCGGAGCGCAAGGGCAAGTACATGTCTCGAGACATGTACTTGCCCTTGCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295139    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009344.3-1444s21c1
Sequence:CCGGCGCGCCTGATCAAGTAGTTTGCTCGAGCAAACTACTTGATCAGGCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009344.3-873s21c1
Sequence:CCGGGAGGGCAAAGAGATCGACTTTCTCGAGAAAGTCGATCTCTTTGCCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009344
VALIDATED
PHLDA1 MISSION shRNA shRNA Plasmid DNA
pleckstrin homology-like domain, family A, member 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000312225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009344.3-920s21c1
Sequence:CCGGCGCCGAGATCACGTTGCAGATCTCGAGATCTGCAACGTGATCTCGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009344.3-964s21c1
Sequence:CCGGCCATACTGGCGGTCAAGTCTACTCGAGTAGACTTGACCGCCAGTATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009344.1-873s1c1
Sequence:CCGGGAGGGCAAAGAGATCGACTTTCTCGAGAAAGTCGATCTCTTTGCCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009344.1-662s1c1
Sequence:CCGGGCTACTGCTCATACCGCCCAACTCGAGTTGGGCGGTATGAGCAGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009344.1-920s1c1
Sequence:CCGGCGCCGAGATCACGTTGCAGATCTCGAGATCTGCAACGTGATCTCGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009344.1-1168s1c1
Sequence:CCGGCGCATCCGCATCCTCATCCTTCTCGAGAAGGATGAGGATGCGGATGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009344.1-774s1c1
Sequence:CCGGCCACCAGTCAAGCTGAAGGAACTCGAGTTCCTTCAGCTTGACTGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009344.3-832s21c1
Sequence:CCGGAGCGCAAGGGCAAGTACATGTCTCGAGACATGTACTTGCCCTTGCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295139    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009344.3-1444s21c1
Sequence:CCGGCGCGCCTGATCAAGTAGTTTGCTCGAGCAAACTACTTGATCAGGCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009344.3-873s21c1
Sequence:CCGGGAGGGCAAAGAGATCGACTTTCTCGAGAAAGTCGATCTCTTTGCCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009344
VALIDATED
PHLDA1 MISSION shRNA Lentiviral Transduction Particles
pleckstrin homology-like domain, family A, member 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000312225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009344.3-920s21c1
Sequence:CCGGCGCCGAGATCACGTTGCAGATCTCGAGATCTGCAACGTGATCTCGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009344.3-964s21c1
Sequence:CCGGCCATACTGGCGGTCAAGTCTACTCGAGTAGACTTGACCGCCAGTATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009344.1-873s1c1
Sequence:CCGGGAGGGCAAAGAGATCGACTTTCTCGAGAAAGTCGATCTCTTTGCCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009344.1-662s1c1
Sequence:CCGGGCTACTGCTCATACCGCCCAACTCGAGTTGGGCGGTATGAGCAGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009344.1-920s1c1
Sequence:CCGGCGCCGAGATCACGTTGCAGATCTCGAGATCTGCAACGTGATCTCGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009344.1-1168s1c1
Sequence:CCGGCGCATCCGCATCCTCATCCTTCTCGAGAAGGATGAGGATGCGGATGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009344.1-774s1c1
Sequence:CCGGCCACCAGTCAAGCTGAAGGAACTCGAGTTCCTTCAGCTTGACTGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009344.3-832s21c1
Sequence:CCGGAGCGCAAGGGCAAGTACATGTCTCGAGACATGTACTTGCCCTTGCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295139    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009344.3-1444s21c1
Sequence:CCGGCGCGCCTGATCAAGTAGTTTGCTCGAGCAAACTACTTGATCAGGCGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009344.3-873s21c1
Sequence:CCGGGAGGGCAAAGAGATCGACTTTCTCGAGAAAGTCGATCTCTTTGCCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007350
VALIDATED
PHLDA1 MISSION shRNA Bacterial Glycerol Stock
pleckstrin homology-like domain, family A, member 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_007350.2-674s1c1
Sequence:CCGGCAAGCTCAAGGAACTGCACTTCTCGAGAAGTGCAGTTCCTTGAGCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152275    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007350.2-1251s1c1
Sequence:CCGGCGAGCACATTTCTATTGTCTTCTCGAGAAGACAATAGAAATGTGCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007350.3-895s21c1
Sequence:CCGGAGGCCATCCTGGCGGTCAAATCTCGAGATTTGACCGCCAGGATGGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150307    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_007350.2-1600s1c1
Sequence:CCGGCCTAATCCGTAGTAATTCCTACTCGAGTAGGAATTACTACGGATTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150983    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_007350.2-1311s1c1
Sequence:CCGGCAGATCAAGTAGTTTGGACATCTCGAGATGTCCAAACTACTTGATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007350.2-839s1c1
Sequence:CCGGGTACAAGAATCGTCAGGCCATCTCGAGATGGCCTGACGATTCTTGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007350.2-1056s1c1
Sequence:CCGGCATCCACATCCACACTCTCATCTCGAGATGAGAGTGTGGATGTGGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007350.2-680s1c1
Sequence:CCGGCAAGGAACTGCACTTCTCCAACTCGAGTTGGAGAAGTGCAGTTCCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007350.3-185s21c1
Sequence:CCGGCTTCAGTGAGCGCTCGCAAGACTCGAGTCTTGCGAGCGCTCACTGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007350.3-1147s21c1
Sequence:CCGGACCCGCATCCGCACCAAATACCTCGAGGTATTTGGTGCGGATGCGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275281    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_007350.3-1642s21c1
Sequence:CCGGCCTAATCCGTAGTAATTCCTACTCGAGTAGGAATTACTACGGATTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007350
VALIDATED
PHLDA1 MISSION shRNA shRNA Plasmid DNA
pleckstrin homology-like domain, family A, member 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_007350.2-674s1c1
Sequence:CCGGCAAGCTCAAGGAACTGCACTTCTCGAGAAGTGCAGTTCCTTGAGCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152275    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007350.2-1251s1c1
Sequence:CCGGCGAGCACATTTCTATTGTCTTCTCGAGAAGACAATAGAAATGTGCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007350.3-895s21c1
Sequence:CCGGAGGCCATCCTGGCGGTCAAATCTCGAGATTTGACCGCCAGGATGGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150307    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_007350.2-1600s1c1
Sequence:CCGGCCTAATCCGTAGTAATTCCTACTCGAGTAGGAATTACTACGGATTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150983    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_007350.2-1311s1c1
Sequence:CCGGCAGATCAAGTAGTTTGGACATCTCGAGATGTCCAAACTACTTGATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007350.2-839s1c1
Sequence:CCGGGTACAAGAATCGTCAGGCCATCTCGAGATGGCCTGACGATTCTTGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007350.2-1056s1c1
Sequence:CCGGCATCCACATCCACACTCTCATCTCGAGATGAGAGTGTGGATGTGGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007350.2-680s1c1
Sequence:CCGGCAAGGAACTGCACTTCTCCAACTCGAGTTGGAGAAGTGCAGTTCCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007350.3-185s21c1
Sequence:CCGGCTTCAGTGAGCGCTCGCAAGACTCGAGTCTTGCGAGCGCTCACTGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007350.3-1147s21c1
Sequence:CCGGACCCGCATCCGCACCAAATACCTCGAGGTATTTGGTGCGGATGCGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275281    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_007350.3-1642s21c1
Sequence:CCGGCCTAATCCGTAGTAATTCCTACTCGAGTAGGAATTACTACGGATTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007350
VALIDATED
PHLDA1 MISSION shRNA Lentiviral Transduction Particles
pleckstrin homology-like domain, family A, member 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_007350.2-674s1c1
Sequence:CCGGCAAGCTCAAGGAACTGCACTTCTCGAGAAGTGCAGTTCCTTGAGCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152275    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007350.2-1251s1c1
Sequence:CCGGCGAGCACATTTCTATTGTCTTCTCGAGAAGACAATAGAAATGTGCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007350.3-895s21c1
Sequence:CCGGAGGCCATCCTGGCGGTCAAATCTCGAGATTTGACCGCCAGGATGGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150307    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_007350.2-1600s1c1
Sequence:CCGGCCTAATCCGTAGTAATTCCTACTCGAGTAGGAATTACTACGGATTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150983    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_007350.2-1311s1c1
Sequence:CCGGCAGATCAAGTAGTTTGGACATCTCGAGATGTCCAAACTACTTGATCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007350.2-839s1c1
Sequence:CCGGGTACAAGAATCGTCAGGCCATCTCGAGATGGCCTGACGATTCTTGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007350.2-1056s1c1
Sequence:CCGGCATCCACATCCACACTCTCATCTCGAGATGAGAGTGTGGATGTGGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007350.2-680s1c1
Sequence:CCGGCAAGGAACTGCACTTCTCCAACTCGAGTTGGAGAAGTGCAGTTCCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007350.3-185s21c1
Sequence:CCGGCTTCAGTGAGCGCTCGCAAGACTCGAGTCTTGCGAGCGCTCACTGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007350.3-1147s21c1
Sequence:CCGGACCCGCATCCGCACCAAATACCTCGAGGTATTTGGTGCGGATGCGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275281    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_007350.3-1642s21c1
Sequence:CCGGCCTAATCCGTAGTAATTCCTACTCGAGTAGGAATTACTACGGATTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)