EMAIL THIS PAGE TO A FRIEND

PHLDA2

pleckstrin homology-like domain, family A, member 2

56 Gene Product Result for
Synonyms: BRW1C BWR1C HLDA2 IPL TSSC3
UniProtKB ID: Q53GA4, O00496
Gene ID:
Human(7262) Summary: This gene is located in a cluster of imprinted genes on chromosome 11p15.5, which is considered to be an important tumor suppressor gene region. Alterations in this region may be associated with the Beckwith-Wiedemann syndrome, Wilms tumor, rhabdomyosarcoma, adrenocortical carcinoma, and lung, ovarian, and breast cancer. This gene has been shown to be imprinted, with preferential expression from the maternal allele in placenta and liver. [provided by RefSeq, Oct 2010]
Mouse(22113) pleckstrin homology-like domain, family A, member 2
Rat(293637) pleckstrin homology-like domain, family A, member 2
Zebrafish(553622) pleckstrin homology-like domain, family A, member 2
chicken(423088) pleckstrin homology-like domain, family A, member 2
naked mole-rat(101709393) pleckstrin homology-like domain, family A, member 2
domestic guinea pig(100719774) pleckstrin homology-like domain, family A, member 2
cow(618810) pleckstrin homology-like domain, family A, member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003311 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003311 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003311 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009434 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009434 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009434 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU043071 MISSION® esiRNA esiRNA targeting mouse Phlda2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003311 Rosetta Predictions human pricing
XM_001065824 Rosetta Predictions rat pricing
XM_215132 Rosetta Predictions rat pricing
NM_009434 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003311 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00085404 predicted 328
2 SASI_Hs01_00085405 predicted 616
3 SASI_Hs01_00085407 predicted 243
4 SASI_Hs01_00085408 predicted 360
5 SASI_Hs01_00085410 predicted 627
6 SASI_Hs01_00085411 predicted 640
7 SASI_Hs01_00085412 predicted 619
8 SASI_Hs02_00335429 predicted 198
9 SASI_Hs02_00335430 predicted 231
10 SASI_Hs02_00335431 predicted 627
11 SASI_Hs01_00085403 predicted 605
12 SASI_Hs01_00085406 predicted 522
13 SASI_Hs01_00085409 predicted 674
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065824 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00315474 predicted 308
2 SASI_Rn02_00315475 predicted 263
3 SASI_Rn02_00315476 predicted 348
4 SASI_Rn02_00315477 predicted 222
5 SASI_Rn02_00315478 predicted 213
6 SASI_Rn02_00315479 predicted 312
7 SASI_Rn02_00315480 predicted 204
8 SASI_Rn02_00315481 predicted 404
9 SASI_Rn02_00315482 predicted 296
10 SASI_Rn02_00315483 predicted 389
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_215132 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00375825 predicted 303
2 SASI_Rn02_00375826 predicted 257
3 SASI_Rn02_00375827 predicted 346
4 SASI_Rn02_00375828 predicted 223
5 SASI_Rn02_00375829 predicted 221
6 SASI_Rn02_00375830 predicted 310
7 SASI_Rn02_00375831 predicted 198
8 SASI_Rn02_00375832 predicted 404
9 SASI_Rn02_00375833 predicted 304
10 SASI_Rn02_00375834 predicted 397
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009434 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00107116 predicted 267
2 SASI_Mm01_00107117 predicted 250
3 SASI_Mm01_00107118 predicted 410
4 SASI_Mm01_00107119 predicted 395
5 SASI_Mm01_00107120 predicted 349
6 SASI_Mm01_00107121 predicted 258
7 SASI_Mm01_00107122 predicted 404
8 SASI_Mm01_00107123 predicted 252
9 SASI_Mm01_00107124 predicted 340
10 SASI_Mm01_00107125 predicted 398
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003311
PHLDA2 MISSION shRNA Bacterial Glycerol Stock
pleckstrin homology-like domain, family A, member 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000419185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003311.3-345s21c1
Sequence:CCGGGCGCTCATCGATTTCCAGAACCTCGAGGTTCTGGAAATCGATGAGCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003311.3-282s21c1
Sequence:CCGGGACCACAAGGAGATCGACTTCCTCGAGGAAGTCGATCTCCTTGTGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162696    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003311.3-677s1c1
Sequence:CCGGCTGGTTCTTTGTAGTCACATACTCGAGTATGTGACTACAAAGAACCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003311.2-116s1c1
Sequence:CCGGCTTCCAGCTATGGAAGAAGAACTCGAGTTCTTCTTCCATAGCTGGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163550    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003311.2-632s1c1
Sequence:CCGGGCGCCTTAAGTTATTGGACTACTCGAGTAGTCCAATAACTTAAGGCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003311.2-251s1c1
Sequence:CCGGCAAGTACGTGTACTTCACCATCTCGAGATGGTGAAGTACACGTACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164641    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003311.2-676s1c1
Sequence:CCGGGCTGGTTCTTTGTAGTCACATCTCGAGATGTGACTACAAAGAACCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003311.2-250s1c1
Sequence:CCGGGCAAGTACGTGTACTTCACCACTCGAGTGGTGAAGTACACGTACTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158679    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003311.3-665s1c1
Sequence:CCGGGTATTTATTTCGCTGGTTCTTCTCGAGAAGAACCAGCGAAATAAATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433026    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003311.3-749s21c1
Sequence:CCGGATCACTTGGCCAGTTTGCTTTCTCGAGAAAGCAAACTGGCCAAGTGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416561    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003311.3-728s21c1
Sequence:CCGGCACTGTGCCCATTGCAAATAACTCGAGTTATTTGCAATGGGCACAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003311
PHLDA2 MISSION shRNA shRNA Plasmid DNA
pleckstrin homology-like domain, family A, member 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000419185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003311.3-345s21c1
Sequence:CCGGGCGCTCATCGATTTCCAGAACCTCGAGGTTCTGGAAATCGATGAGCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003311.3-282s21c1
Sequence:CCGGGACCACAAGGAGATCGACTTCCTCGAGGAAGTCGATCTCCTTGTGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162696    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003311.3-677s1c1
Sequence:CCGGCTGGTTCTTTGTAGTCACATACTCGAGTATGTGACTACAAAGAACCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003311.2-116s1c1
Sequence:CCGGCTTCCAGCTATGGAAGAAGAACTCGAGTTCTTCTTCCATAGCTGGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163550    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003311.2-632s1c1
Sequence:CCGGGCGCCTTAAGTTATTGGACTACTCGAGTAGTCCAATAACTTAAGGCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003311.2-251s1c1
Sequence:CCGGCAAGTACGTGTACTTCACCATCTCGAGATGGTGAAGTACACGTACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164641    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003311.2-676s1c1
Sequence:CCGGGCTGGTTCTTTGTAGTCACATCTCGAGATGTGACTACAAAGAACCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003311.2-250s1c1
Sequence:CCGGGCAAGTACGTGTACTTCACCACTCGAGTGGTGAAGTACACGTACTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158679    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003311.3-665s1c1
Sequence:CCGGGTATTTATTTCGCTGGTTCTTCTCGAGAAGAACCAGCGAAATAAATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433026    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003311.3-749s21c1
Sequence:CCGGATCACTTGGCCAGTTTGCTTTCTCGAGAAAGCAAACTGGCCAAGTGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416561    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003311.3-728s21c1
Sequence:CCGGCACTGTGCCCATTGCAAATAACTCGAGTTATTTGCAATGGGCACAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003311
PHLDA2 MISSION shRNA Lentiviral Transduction Particles
pleckstrin homology-like domain, family A, member 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000419185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003311.3-345s21c1
Sequence:CCGGGCGCTCATCGATTTCCAGAACCTCGAGGTTCTGGAAATCGATGAGCGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003311.3-282s21c1
Sequence:CCGGGACCACAAGGAGATCGACTTCCTCGAGGAAGTCGATCTCCTTGTGGTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162696    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003311.3-677s1c1
Sequence:CCGGCTGGTTCTTTGTAGTCACATACTCGAGTATGTGACTACAAAGAACCAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003311.2-116s1c1
Sequence:CCGGCTTCCAGCTATGGAAGAAGAACTCGAGTTCTTCTTCCATAGCTGGAAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163550    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003311.2-632s1c1
Sequence:CCGGGCGCCTTAAGTTATTGGACTACTCGAGTAGTCCAATAACTTAAGGCGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003311.2-251s1c1
Sequence:CCGGCAAGTACGTGTACTTCACCATCTCGAGATGGTGAAGTACACGTACTTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164641    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003311.2-676s1c1
Sequence:CCGGGCTGGTTCTTTGTAGTCACATCTCGAGATGTGACTACAAAGAACCAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003311.2-250s1c1
Sequence:CCGGGCAAGTACGTGTACTTCACCACTCGAGTGGTGAAGTACACGTACTTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158679    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003311.3-665s1c1
Sequence:CCGGGTATTTATTTCGCTGGTTCTTCTCGAGAAGAACCAGCGAAATAAATACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433026    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003311.3-749s21c1
Sequence:CCGGATCACTTGGCCAGTTTGCTTTCTCGAGAAAGCAAACTGGCCAAGTGATTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416561    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003311.3-728s21c1
Sequence:CCGGCACTGTGCCCATTGCAAATAACTCGAGTTATTTGCAATGGGCACAGTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009434
PHLDA2 MISSION shRNA Bacterial Glycerol Stock
pleckstrin homology-like domain, family A, member 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000362902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009434.2-409s21c1
Sequence:CCGGTCAGCGCTCTGAGTCTGAAATCTCGAGATTTCAGACTCAGAGCGCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009434.2-273s21c1
Sequence:CCGGTCACCATCGTCACCAACTATTCTCGAGAATAGTTGGTGACGATGGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362831    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009434.2-563s21c1
Sequence:CCGGCTGCTCTTCACCGAAGATATTCTCGAGAATATCTTCGGTGAAGAGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000362904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009434.2-72s21c1
Sequence:CCGGAGACCTCCGACGAGATCCTTTCTCGAGAAAGGATCTCGTCGGAGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009434.1-113s1c1
Sequence:CCGGGTTCCAGGTATGGAAGAAGAACTCGAGTTCTTCTTCCATACCTGGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009434.1-275s1c1
Sequence:CCGGCTATTACAAGGAGATCGACTTCTCGAGAAGTCGATCTCCTTGTAATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009434.1-236s1c1
Sequence:CCGGGCACACCTCTAAGTACGTGTACTCGAGTACACGTACTTAGAGGTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009434.1-53s1c1
Sequence:CCGGCGTGAAGACCTCCGACGAGATCTCGAGATCTCGTCGGAGGTCTTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009434.1-254s1c1
Sequence:CCGGGTACTTCACCATCGTCACCAACTCGAGTTGGTGACGATGGTGAAGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009434
PHLDA2 MISSION shRNA shRNA Plasmid DNA
pleckstrin homology-like domain, family A, member 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000362902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009434.2-409s21c1
Sequence:CCGGTCAGCGCTCTGAGTCTGAAATCTCGAGATTTCAGACTCAGAGCGCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009434.2-273s21c1
Sequence:CCGGTCACCATCGTCACCAACTATTCTCGAGAATAGTTGGTGACGATGGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362831    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009434.2-563s21c1
Sequence:CCGGCTGCTCTTCACCGAAGATATTCTCGAGAATATCTTCGGTGAAGAGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009434.2-72s21c1
Sequence:CCGGAGACCTCCGACGAGATCCTTTCTCGAGAAAGGATCTCGTCGGAGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009434.1-113s1c1
Sequence:CCGGGTTCCAGGTATGGAAGAAGAACTCGAGTTCTTCTTCCATACCTGGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009434.1-275s1c1
Sequence:CCGGCTATTACAAGGAGATCGACTTCTCGAGAAGTCGATCTCCTTGTAATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009434.1-236s1c1
Sequence:CCGGGCACACCTCTAAGTACGTGTACTCGAGTACACGTACTTAGAGGTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009434.1-53s1c1
Sequence:CCGGCGTGAAGACCTCCGACGAGATCTCGAGATCTCGTCGGAGGTCTTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009434.1-254s1c1
Sequence:CCGGGTACTTCACCATCGTCACCAACTCGAGTTGGTGACGATGGTGAAGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009434
PHLDA2 MISSION shRNA Lentiviral Transduction Particles
pleckstrin homology-like domain, family A, member 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000362902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009434.2-409s21c1
Sequence:CCGGTCAGCGCTCTGAGTCTGAAATCTCGAGATTTCAGACTCAGAGCGCTGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009434.2-273s21c1
Sequence:CCGGTCACCATCGTCACCAACTATTCTCGAGAATAGTTGGTGACGATGGTGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362831    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009434.2-563s21c1
Sequence:CCGGCTGCTCTTCACCGAAGATATTCTCGAGAATATCTTCGGTGAAGAGCAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000362904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009434.2-72s21c1
Sequence:CCGGAGACCTCCGACGAGATCCTTTCTCGAGAAAGGATCTCGTCGGAGGTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009434.1-113s1c1
Sequence:CCGGGTTCCAGGTATGGAAGAAGAACTCGAGTTCTTCTTCCATACCTGGAACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009434.1-275s1c1
Sequence:CCGGCTATTACAAGGAGATCGACTTCTCGAGAAGTCGATCTCCTTGTAATAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009434.1-236s1c1
Sequence:CCGGGCACACCTCTAAGTACGTGTACTCGAGTACACGTACTTAGAGGTGTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009434.1-53s1c1
Sequence:CCGGCGTGAAGACCTCCGACGAGATCTCGAGATCTCGTCGGAGGTCTTCACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009434.1-254s1c1
Sequence:CCGGGTACTTCACCATCGTCACCAACTCGAGTTGGTGACGATGGTGAAGTACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)