EMAIL THIS PAGE TO A FRIEND

PHLDA3

pleckstrin homology-like domain, family A, member 3

60 Gene Product Result for
Synonyms: TIH1
UniProtKB ID: Q9Y5J5, B2R5A4, Q53HD6, Q8NBW9
Gene ID:
Mouse(27280) pleckstrin homology-like domain, family A, member 3
Rat(363989) pleckstrin homology-like domain, family A, member 3
domestic guinea pig(100733435) pleckstrin homology-like domain, family A, member 3
naked mole-rat(101720374) pleckstrin homology-like domain, family A, member 3
Zebrafish(368779) pleckstrin homology-like domain, family A, member 3
domestic cat(101099857) pleckstrin homology-like domain, family A, member 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013750 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013750 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013750 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012396 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012396 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012396 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU053891 MISSION® esiRNA esiRNA targeting mouse Phlda3 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012396 Rosetta Predictions human pricing
NM_001012206 Rosetta Predictions rat pricing
XM_573458 Rosetta Predictions rat pricing
NM_013750 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012396 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00344205 predicted 953
2 SASI_Hs01_00085021 predicted 984
3 SASI_Hs01_00085014 predicted 1260
4 SASI_Hs01_00085015 predicted 1178
5 SASI_Hs01_00085016 predicted 777
6 SASI_Hs02_00344206 predicted 823
7 SASI_Hs02_00344207 predicted 867
8 SASI_Hs01_00085022 predicted 1098
9 SASI_Hs02_00344208 predicted 812
10 SASI_Hs02_00344209 predicted 774
11 SASI_Hs01_00085017 predicted 872
12 SASI_Hs01_00085018 predicted 822
13 SASI_Hs01_00085019 predicted 540
14 SASI_Hs01_00085020 predicted 582
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012206 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00085810 predicted 928
2 SASI_Rn02_00200449 predicted 1075
3 SASI_Rn01_00085812 predicted 502
4 SASI_Rn01_00085813 predicted 795
5 SASI_Rn01_00085814 predicted 1038
6 SASI_Rn01_00085815 predicted 910
7 SASI_Rn01_00085816 predicted 774
8 SASI_Rn01_00085817 predicted 882
9 SASI_Rn01_00085818 predicted 939
10 SASI_Rn02_00200450 predicted 890
11 SASI_Rn01_00085811 predicted 1024
12 SASI_Rn01_00085819 predicted 992
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573458 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00194486 predicted 950
2 SASI_Rn01_00194487 predicted 1043
3 SASI_Rn01_00194488 predicted 521
4 SASI_Rn01_00194489 predicted 817
5 SASI_Rn01_00194490 predicted 1053
6 SASI_Rn01_00194491 predicted 931
7 SASI_Rn01_00194492 predicted 800
8 SASI_Rn01_00194493 predicted 904
9 SASI_Rn01_00194494 predicted 956
10 SASI_Rn01_00194495 predicted 1011
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013750 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00071921 predicted 460
2 SASI_Mm01_00071922 predicted 915
3 SASI_Mm01_00071923 predicted 786
4 SASI_Mm01_00071924 predicted 990
5 SASI_Mm01_00071925 predicted 671
6 SASI_Mm01_00071926 predicted 807
7 SASI_Mm01_00071927 predicted 513
8 SASI_Mm01_00071928 predicted 820
9 SASI_Mm01_00071929 predicted 687
10 SASI_Mm01_00071930 predicted 459
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013750
PHLDA3 MISSION shRNA Bacterial Glycerol Stock
pleckstrin homology-like domain, family A, member 3
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000375270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013750.2-532s21c1
Sequence:CCGGCAAAGCCGTGGAGTGCGTAGACTCGAGTCTACGCACTCCACGGCTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013750.2-680s21c1
Sequence:CCGGCAACAGGCCATCCAGACTGTGCTCGAGCACAGTCTGGATGGCCTGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013750.2-739s21c1
Sequence:CCGGCTAAACCATGAGGCGTATCATCTCGAGATGATACGCCTCATGGTTTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013750.2-658s21c1
Sequence:CCGGGGGCCTGGTCAAGTTCAAGAACTCGAGTTCTTGAACTTGACCAGGCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013750.2-633s21c1
Sequence:CCGGCTGGCTGGAACGCTCAGATCACTCGAGTGATCTGAGCGTTCCAGCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013750.1-520s1c1
Sequence:CCGGCATCTACTTCACGCTAGTGACCTCGAGGTCACTAGCGTGAAGTAGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200337    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013750.1-1258s1c1
Sequence:CCGGGCCCATCTGTACCCTTTCTTTCTCGAGAAAGAAAGGGTACAGATGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198701    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013750.1-1269s1c1
Sequence:CCGGCCCTTTCTTTGCACACTTCTTCTCGAGAAGAAGTGTGCAAAGAAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013750
PHLDA3 MISSION shRNA shRNA Plasmid DNA
pleckstrin homology-like domain, family A, member 3
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000375270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013750.2-532s21c1
Sequence:CCGGCAAAGCCGTGGAGTGCGTAGACTCGAGTCTACGCACTCCACGGCTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013750.2-680s21c1
Sequence:CCGGCAACAGGCCATCCAGACTGTGCTCGAGCACAGTCTGGATGGCCTGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013750.2-739s21c1
Sequence:CCGGCTAAACCATGAGGCGTATCATCTCGAGATGATACGCCTCATGGTTTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013750.2-658s21c1
Sequence:CCGGGGGCCTGGTCAAGTTCAAGAACTCGAGTTCTTGAACTTGACCAGGCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013750.2-633s21c1
Sequence:CCGGCTGGCTGGAACGCTCAGATCACTCGAGTGATCTGAGCGTTCCAGCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013750.1-520s1c1
Sequence:CCGGCATCTACTTCACGCTAGTGACCTCGAGGTCACTAGCGTGAAGTAGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200337    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013750.1-1258s1c1
Sequence:CCGGGCCCATCTGTACCCTTTCTTTCTCGAGAAAGAAAGGGTACAGATGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198701    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013750.1-1269s1c1
Sequence:CCGGCCCTTTCTTTGCACACTTCTTCTCGAGAAGAAGTGTGCAAAGAAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013750
PHLDA3 MISSION shRNA Lentiviral Transduction Particles
pleckstrin homology-like domain, family A, member 3
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000375270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013750.2-532s21c1
Sequence:CCGGCAAAGCCGTGGAGTGCGTAGACTCGAGTCTACGCACTCCACGGCTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013750.2-680s21c1
Sequence:CCGGCAACAGGCCATCCAGACTGTGCTCGAGCACAGTCTGGATGGCCTGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013750.2-739s21c1
Sequence:CCGGCTAAACCATGAGGCGTATCATCTCGAGATGATACGCCTCATGGTTTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013750.2-658s21c1
Sequence:CCGGGGGCCTGGTCAAGTTCAAGAACTCGAGTTCTTGAACTTGACCAGGCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013750.2-633s21c1
Sequence:CCGGCTGGCTGGAACGCTCAGATCACTCGAGTGATCTGAGCGTTCCAGCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013750.1-520s1c1
Sequence:CCGGCATCTACTTCACGCTAGTGACCTCGAGGTCACTAGCGTGAAGTAGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200337    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013750.1-1258s1c1
Sequence:CCGGGCCCATCTGTACCCTTTCTTTCTCGAGAAAGAAAGGGTACAGATGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198701    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013750.1-1269s1c1
Sequence:CCGGCCCTTTCTTTGCACACTTCTTCTCGAGAAGAAGTGTGCAAAGAAAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012396
VALIDATED
PHLDA3 MISSION shRNA Bacterial Glycerol Stock
pleckstrin homology-like domain, family A, member 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183624    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_012396.2-1452s1c1
Sequence:CCGGGTTTGGCCATTAGCATTTCATCTCGAGATGAAATGCTAATGGCCAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179973    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_012396.2-781s1c1
Sequence:CCGGCACCATCTTTCCTTCATGCTACTCGAGTAGCATGAAGGAAAGATGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183331    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_012396.2-1457s1c1
Sequence:CCGGGCCATTAGCATTTCATGTCTTCTCGAGAAGACATGAAATGCTAATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180589    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_012396.2-780s1c1
Sequence:CCGGGCACCATCTTTCCTTCATGCTCTCGAGAGCATGAAGGAAAGATGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181124    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_012396.2-832s1c1
Sequence:CCGGCTTTGTTGTTCCCTCTGGCTTCTCGAGAAGCCAGAGGGAACAACAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012396
VALIDATED
PHLDA3 MISSION shRNA shRNA Plasmid DNA
pleckstrin homology-like domain, family A, member 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183624    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_012396.2-1452s1c1
Sequence:CCGGGTTTGGCCATTAGCATTTCATCTCGAGATGAAATGCTAATGGCCAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179973    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_012396.2-781s1c1
Sequence:CCGGCACCATCTTTCCTTCATGCTACTCGAGTAGCATGAAGGAAAGATGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183331    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_012396.2-1457s1c1
Sequence:CCGGGCCATTAGCATTTCATGTCTTCTCGAGAAGACATGAAATGCTAATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180589    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_012396.2-780s1c1
Sequence:CCGGGCACCATCTTTCCTTCATGCTCTCGAGAGCATGAAGGAAAGATGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181124    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_012396.2-832s1c1
Sequence:CCGGCTTTGTTGTTCCCTCTGGCTTCTCGAGAAGCCAGAGGGAACAACAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012396
VALIDATED
PHLDA3 MISSION shRNA Lentiviral Transduction Particles
pleckstrin homology-like domain, family A, member 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183624    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_012396.2-1452s1c1
Sequence:CCGGGTTTGGCCATTAGCATTTCATCTCGAGATGAAATGCTAATGGCCAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179973    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_012396.2-781s1c1
Sequence:CCGGCACCATCTTTCCTTCATGCTACTCGAGTAGCATGAAGGAAAGATGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183331    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_012396.2-1457s1c1
Sequence:CCGGGCCATTAGCATTTCATGTCTTCTCGAGAAGACATGAAATGCTAATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180589    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_012396.2-780s1c1
Sequence:CCGGGCACCATCTTTCCTTCATGCTCTCGAGAGCATGAAGGAAAGATGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181124    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_012396.2-832s1c1
Sequence:CCGGCTTTGTTGTTCCCTCTGGCTTCTCGAGAAGCCAGAGGGAACAACAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)