EMAIL THIS PAGE TO A FRIEND

PHLDB2

pleckstrin homology-like domain, family B, member 2

144 Gene Product Result for
Synonyms: LL5b LL5beta
Gene ID:
Mouse(208177) pleckstrin homology-like domain, family B, member 2
Rat(685611) pleckstrin homology-like domain, family B, member 2
chicken(418418) pleckstrin homology-like domain, family B, member 2
dog(478560) pleckstrin homology-like domain, family B, member 2
domestic cat(101086338) pleckstrin homology-like domain, family B, member 2
Horse(100071564) pleckstrin homology-like domain, family B, member 2
cow(509784) pleckstrin homology-like domain, family B, member 2
sheep(101118837) pleckstrin homology-like domain, family B, member 2
domestic guinea pig(100731009) pleckstrin homology-like domain, family B, member 2
naked mole-rat(101702937) pleckstrin homology-like domain, family B, member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153412 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153412 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153412 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_145753 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145753 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145753 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU001931 MISSION® esiRNA esiRNA targeting mouse Phldb2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145753 Rosetta Predictions human pricing
XM_001064525 Rosetta Predictions rat pricing
NM_153412 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145753 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00031229 predicted 267
2 SASI_Hs02_00365337 predicted 1274
3 SASI_Hs01_00031230 predicted 766
4 SASI_Hs02_00365338 predicted 2601
5 SASI_Hs01_00031232 predicted 3764
6 SASI_Hs01_00031233 predicted 3638
7 SASI_Hs01_00031234 predicted 3380
8 SASI_Hs02_00365339 predicted 1359
9 SASI_Hs01_00031236 predicted 2961
10 SASI_Hs01_00031237 predicted 2294
11 SASI_Hs01_00031231 predicted 2486
12 SASI_Hs01_00031235 predicted 2922
13 SASI_Hs01_00031238 predicted 2023
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064525 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00310849 predicted 2669
2 SASI_Rn02_00310850 predicted 2121
3 SASI_Rn02_00310851 predicted 267
4 SASI_Rn02_00310852 predicted 1340
5 SASI_Rn02_00310853 predicted 2328
6 SASI_Rn02_00310854 predicted 1514
7 SASI_Rn02_00310855 predicted 1987
8 SASI_Rn02_00310856 predicted 946
9 SASI_Rn02_00310857 predicted 442
10 SASI_Rn02_00310858 predicted 2469
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153412 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00144569 predicted 341
2 SASI_Mm01_00144570 predicted 2433
3 SASI_Mm02_00343197 predicted 2667
4 SASI_Mm01_00144571 predicted 3820
5 SASI_Mm01_00144572 predicted 628
6 SASI_Mm01_00144573 predicted 2650
7 SASI_Mm01_00144574 predicted 3258
8 SASI_Mm01_00144575 predicted 2529
9 SASI_Mm01_00144577 predicted 1062
10 SASI_Mm01_00144578 predicted 2420
11 SASI_Mm01_00144576 predicted 1921
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153412
VALIDATED
PHLDB2 MISSION shRNA Bacterial Glycerol Stock
pleckstrin homology-like domain, family B, member 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000105951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153412.1-302s1c1
Sequence:CCGGGCCCGAGGAAATACTCATCAACTCGAGTTGATGAGTATTTCCTCGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153412.1-1065s1c1
Sequence:CCGGCCTAGTGGATAGTGACAATTACTCGAGTAATTGTCACTATCCACTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153412.1-1064s1c1
Sequence:CCGGGCCTAGTGGATAGTGACAATTCTCGAGAATTGTCACTATCCACTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153412.1-3877s1c1
Sequence:CCGGCGGATCTGGATGGACGTTATACTCGAGTATAACGTCCATCCAGATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105950    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153412.1-4644s1c1
Sequence:CCGGGCAGTTTCAATTAAGGAGAATCTCGAGATTCTCCTTAATTGAAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153412
VALIDATED
PHLDB2 MISSION shRNA shRNA Plasmid DNA
pleckstrin homology-like domain, family B, member 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000105951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153412.1-302s1c1
Sequence:CCGGGCCCGAGGAAATACTCATCAACTCGAGTTGATGAGTATTTCCTCGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153412.1-1065s1c1
Sequence:CCGGCCTAGTGGATAGTGACAATTACTCGAGTAATTGTCACTATCCACTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153412.1-1064s1c1
Sequence:CCGGGCCTAGTGGATAGTGACAATTCTCGAGAATTGTCACTATCCACTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153412.1-3877s1c1
Sequence:CCGGCGGATCTGGATGGACGTTATACTCGAGTATAACGTCCATCCAGATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105950    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153412.1-4644s1c1
Sequence:CCGGGCAGTTTCAATTAAGGAGAATCTCGAGATTCTCCTTAATTGAAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153412
VALIDATED
PHLDB2 MISSION shRNA Lentiviral Transduction Particles
pleckstrin homology-like domain, family B, member 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000105951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153412.1-302s1c1
Sequence:CCGGGCCCGAGGAAATACTCATCAACTCGAGTTGATGAGTATTTCCTCGGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153412.1-1065s1c1
Sequence:CCGGCCTAGTGGATAGTGACAATTACTCGAGTAATTGTCACTATCCACTAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153412.1-1064s1c1
Sequence:CCGGGCCTAGTGGATAGTGACAATTCTCGAGAATTGTCACTATCCACTAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153412.1-3877s1c1
Sequence:CCGGCGGATCTGGATGGACGTTATACTCGAGTATAACGTCCATCCAGATCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105950    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153412.1-4644s1c1
Sequence:CCGGGCAGTTTCAATTAAGGAGAATCTCGAGATTCTCCTTAATTGAAACTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145753
VALIDATED
PHLDB2 MISSION shRNA Bacterial Glycerol Stock
pleckstrin homology-like domain, family B, member 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_145753.1-1377s1c1
Sequence:CCGGGACGTGATGACCTGATGGATTCTCGAGAATCCATCAGGTCATCACGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135339    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_145753.1-5248s1c1
Sequence:CCGGCCCTGTAGTGATGTAAGACTACTCGAGTAGTCTTACATCACTACAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136028    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_145753.1-3776s1c1
Sequence:CCGGGCAGACGGCAATAATCTCTTACTCGAGTAAGAGATTATTGCCGTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_145753.1-1880s1c1
Sequence:CCGGGCAATGGAAGAAACCCGGATACTCGAGTATCCGGGTTTCTTCCATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_145753.1-192s1c1
Sequence:CCGGCTGTTGAGAACGATTCCCAAACTCGAGTTTGGGAATCGTTCTCAACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_145753.2-3937s21c1
Sequence:CCGGACTCATGACAGAATCTATTATCTCGAGATAATAGATTCTGTCATGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_145753.2-571s21c1
Sequence:CCGGGACTATTCTGGCTCCTATTTACTCGAGTAAATAGGAGCCAGAATAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_145753.2-3141s21c1
Sequence:CCGGGAGGATGCTCAGAGGTTATAACTCGAGTTATAACCTCTGAGCATCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_145753.2-1279s21c1
Sequence:CCGGGATCTACCTCATAGCGTAATACTCGAGTATTACGCTATGAGGTAGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274979    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_145753.2-4072s21c1
Sequence:CCGGGCAGACGGCAATAATCTCTTACTCGAGTAAGAGATTATTGCCGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145753
VALIDATED
PHLDB2 MISSION shRNA shRNA Plasmid DNA
pleckstrin homology-like domain, family B, member 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_145753.1-1377s1c1
Sequence:CCGGGACGTGATGACCTGATGGATTCTCGAGAATCCATCAGGTCATCACGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135339    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_145753.1-5248s1c1
Sequence:CCGGCCCTGTAGTGATGTAAGACTACTCGAGTAGTCTTACATCACTACAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136028    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_145753.1-3776s1c1
Sequence:CCGGGCAGACGGCAATAATCTCTTACTCGAGTAAGAGATTATTGCCGTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_145753.1-1880s1c1
Sequence:CCGGGCAATGGAAGAAACCCGGATACTCGAGTATCCGGGTTTCTTCCATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_145753.1-192s1c1
Sequence:CCGGCTGTTGAGAACGATTCCCAAACTCGAGTTTGGGAATCGTTCTCAACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_145753.2-3937s21c1
Sequence:CCGGACTCATGACAGAATCTATTATCTCGAGATAATAGATTCTGTCATGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_145753.2-571s21c1
Sequence:CCGGGACTATTCTGGCTCCTATTTACTCGAGTAAATAGGAGCCAGAATAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_145753.2-3141s21c1
Sequence:CCGGGAGGATGCTCAGAGGTTATAACTCGAGTTATAACCTCTGAGCATCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_145753.2-1279s21c1
Sequence:CCGGGATCTACCTCATAGCGTAATACTCGAGTATTACGCTATGAGGTAGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274979    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_145753.2-4072s21c1
Sequence:CCGGGCAGACGGCAATAATCTCTTACTCGAGTAAGAGATTATTGCCGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145753
VALIDATED
PHLDB2 MISSION shRNA Lentiviral Transduction Particles
pleckstrin homology-like domain, family B, member 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_145753.1-1377s1c1
Sequence:CCGGGACGTGATGACCTGATGGATTCTCGAGAATCCATCAGGTCATCACGTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135339    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_145753.1-5248s1c1
Sequence:CCGGCCCTGTAGTGATGTAAGACTACTCGAGTAGTCTTACATCACTACAGGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136028    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_145753.1-3776s1c1
Sequence:CCGGGCAGACGGCAATAATCTCTTACTCGAGTAAGAGATTATTGCCGTCTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_145753.1-1880s1c1
Sequence:CCGGGCAATGGAAGAAACCCGGATACTCGAGTATCCGGGTTTCTTCCATTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_145753.1-192s1c1
Sequence:CCGGCTGTTGAGAACGATTCCCAAACTCGAGTTTGGGAATCGTTCTCAACAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_145753.2-3937s21c1
Sequence:CCGGACTCATGACAGAATCTATTATCTCGAGATAATAGATTCTGTCATGAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_145753.2-571s21c1
Sequence:CCGGGACTATTCTGGCTCCTATTTACTCGAGTAAATAGGAGCCAGAATAGTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_145753.2-3141s21c1
Sequence:CCGGGAGGATGCTCAGAGGTTATAACTCGAGTTATAACCTCTGAGCATCCTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_145753.2-1279s21c1
Sequence:CCGGGATCTACCTCATAGCGTAATACTCGAGTATTACGCTATGAGGTAGATCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274979    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_145753.2-4072s21c1
Sequence:CCGGGCAGACGGCAATAATCTCTTACTCGAGTAAGAGATTATTGCCGTCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)