EMAIL THIS PAGE TO A FRIEND

PHLDB3

pleckstrin homology-like domain, family B, member 3

87 Gene Product Result for
UniProtKB ID: Q6NSJ2, Q8N7Z4
Gene ID:
Mouse(232970) pleckstrin homology-like domain, family B, member 3
Rat(308431) pleckstrin homology-like domain, family B, member 3
naked mole-rat(101698377) pleckstrin homology-like domain, family B, member 3
domestic guinea pig(100726631) pleckstrin homology-like domain, family B, member 3
cow(533145) pleckstrin homology-like domain, family B, member 3
sheep(101105772) pleckstrin homology-like domain, family B, member 3
dog(484470) pleckstrin homology-like domain, family B, member 3
domestic cat(101081098) pleckstrin homology-like domain, family B, member 3
dog(612419) pleckstrin homology-like domain, family B, member 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA043425 Anti-PHLDB3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001102613 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001102613 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001102613 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_198850 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198850 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198850 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU136011 MISSION® esiRNA esiRNA human PHLDB3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198850 Rosetta Predictions human pricing
XM_928224 Rosetta Predictions human pricing
XM_001076710 Rosetta Predictions rat pricing
XM_218447 Rosetta Predictions rat pricing
NM_001102613 Rosetta Predictions mouse pricing
XM_149900 Rosetta Predictions mouse pricing
XM_991046 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198850 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00372365 predicted 1483
2 SASI_Hs01_00197751 predicted 803
3 SASI_Hs01_00197753 predicted 354
4 SASI_Hs01_00197754 predicted 907
5 SASI_Hs02_00372366 predicted 1276
6 SASI_Hs01_00197755 predicted 824
7 SASI_Hs01_00197756 predicted 369
8 SASI_Hs02_00372367 predicted 946
9 SASI_Hs01_00197757 predicted 877
10 SASI_Hs01_00197758 predicted 584
11 SASI_Hs01_00197750 predicted 476
12 SASI_Hs01_00197752 predicted 580
13 SASI_Hs01_00197759 predicted 971
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_928224 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00278026 predicted 344
2 SASI_Hs01_00278027 predicted 337
3 SASI_Hs01_00278028 predicted 825
4 SASI_Hs01_00278029 predicted 828
5 SASI_Hs01_00278030 predicted 828
6 SASI_Hs01_00278031 predicted 829
7 SASI_Hs01_00278032 predicted 346
8 SASI_Hs01_00278033 predicted 829
9 SASI_Hs01_00278034 predicted 344
10 SASI_Hs01_00278035 predicted 343
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076710 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00354220 predicted 1502
2 SASI_Rn02_00354221 predicted 1207
3 SASI_Rn02_00354222 predicted 1117
4 SASI_Rn02_00354223 predicted 985
5 SASI_Rn02_00354224 predicted 1204
6 SASI_Rn02_00354225 predicted 775
7 SASI_Rn02_00354226 predicted 1644
8 SASI_Rn02_00354227 predicted 1306
9 SASI_Rn02_00354228 predicted 1966
10 SASI_Rn02_00354229 predicted 1630
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_218447 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00181560 predicted 529
2 SASI_Rn01_00181561 predicted 502
3 SASI_Rn01_00181563 predicted 484
4 SASI_Rn02_00377741 predicted 339
5 SASI_Rn01_00181564 predicted 404
6 SASI_Rn01_00181565 predicted 620
7 SASI_Rn01_00181566 predicted 509
8 SASI_Rn01_00181567 predicted 423
9 SASI_Rn01_00181568 predicted 438
10 SASI_Rn01_00181569 predicted 611
11 SASI_Rn01_00181562 predicted 588
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001102613 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00303019 predicted 724
2 SASI_Mm02_00303020 predicted 1039
3 SASI_Mm02_00303021 predicted 949
4 SASI_Mm02_00303022 predicted 595
5 SASI_Mm02_00303023 predicted 1264
6 SASI_Mm02_00303024 predicted 1242
7 SASI_Mm02_00303025 predicted 766
8 SASI_Mm02_00303026 predicted 601
9 SASI_Mm02_00303027 predicted 633
10 SASI_Mm02_00303028 predicted 811
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_149900 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00247505 predicted 351
2 SASI_Mm01_00247506 predicted 256
3 SASI_Mm01_00247507 predicted 556
4 SASI_Mm01_00247508 predicted 257
5 SASI_Mm01_00247509 predicted 578
6 SASI_Mm01_00247510 predicted 554
7 SASI_Mm01_00247511 predicted 556
8 SASI_Mm01_00247512 predicted 353
9 SASI_Mm01_00247513 predicted 283
10 SASI_Mm01_00247514 predicted 355
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_991046 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00450544 predicted 720
2 SASI_Mm02_00450545 predicted 1044
3 SASI_Mm02_00450546 predicted 947
4 SASI_Mm02_00450547 predicted 595
5 SASI_Mm02_00450548 predicted 1268
6 SASI_Mm02_00450549 predicted 1240
7 SASI_Mm02_00450550 predicted 772
8 SASI_Mm02_00450551 predicted 609
9 SASI_Mm02_00450552 predicted 632
10 SASI_Mm02_00450553 predicted 814
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001102613
PHLDB3 MISSION shRNA Bacterial Glycerol Stock
pleckstrin homology-like domain, family B, member 3
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000267467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102613.1-635s21c1
Sequence:CCGGGGCACAAGGACAGCTTGATTCCTCGAGGAATCAAGCTGTCCTTGTGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102613.1-947s21c1
Sequence:CCGGGGAAGCTGTTCAGGCTCTTACCTCGAGGTAAGAGCCTGAACAGCTTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102613.1-1759s21c1
Sequence:CCGGAGCTCAAAGGCGTCATCTATTCTCGAGAATAGATGACGCCTTTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102613.1-1373s21c1
Sequence:CCGGTCGTTCAGACATCGCACACATCTCGAGATGTGTGCGATGTCTGAACGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001102613
PHLDB3 MISSION shRNA shRNA Plasmid DNA
pleckstrin homology-like domain, family B, member 3
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000267467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102613.1-635s21c1
Sequence:CCGGGGCACAAGGACAGCTTGATTCCTCGAGGAATCAAGCTGTCCTTGTGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102613.1-947s21c1
Sequence:CCGGGGAAGCTGTTCAGGCTCTTACCTCGAGGTAAGAGCCTGAACAGCTTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102613.1-1759s21c1
Sequence:CCGGAGCTCAAAGGCGTCATCTATTCTCGAGAATAGATGACGCCTTTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102613.1-1373s21c1
Sequence:CCGGTCGTTCAGACATCGCACACATCTCGAGATGTGTGCGATGTCTGAACGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001102613
PHLDB3 MISSION shRNA Lentiviral Transduction Particles
pleckstrin homology-like domain, family B, member 3
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000267467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102613.1-635s21c1
Sequence:CCGGGGCACAAGGACAGCTTGATTCCTCGAGGAATCAAGCTGTCCTTGTGCCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102613.1-947s21c1
Sequence:CCGGGGAAGCTGTTCAGGCTCTTACCTCGAGGTAAGAGCCTGAACAGCTTCCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102613.1-1759s21c1
Sequence:CCGGAGCTCAAAGGCGTCATCTATTCTCGAGAATAGATGACGCCTTTGAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001102613.1-1373s21c1
Sequence:CCGGTCGTTCAGACATCGCACACATCTCGAGATGTGTGCGATGTCTGAACGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198850
PHLDB3 MISSION shRNA Bacterial Glycerol Stock
pleckstrin homology-like domain, family B, member 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000159507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198850.2-1351s1c1
Sequence:CCGGCCTGAATATTTCATGAGCATTCTCGAGAATGCTCATGAAATATTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198850.2-1277s1c1
Sequence:CCGGGCCTGTCATGTTCTTCTGAATCTCGAGATTCAGAAGAACATGACAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198850.2-1024s1c1
Sequence:CCGGGATGAGGGAACAACTGGATGTCTCGAGACATCCAGTTGTTCCCTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198850.2-524s1c1
Sequence:CCGGGAGGAAGAAGAAGTGGGAGAACTCGAGTTCTCCCACTTCTTCTTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198850.2-1833s1c1
Sequence:CCGGCCACCACATTCTTTGCCTCTACTCGAGTAGAGGCAAAGAATGTGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198850.2-1022s1c1
Sequence:CCGGGAGATGAGGGAACAACTGGATCTCGAGATCCAGTTGTTCCCTCATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198850.2-1713s1c1
Sequence:CCGGCCTGGTCTTAAACTCTTGGATCTCGAGATCCAAGAGTTTAAGACCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198850.2-1756s1c1
Sequence:CCGGCCTTTCAAGATGCTGGGATTACTCGAGTAATCCCAGCATCTTGAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198850
PHLDB3 MISSION shRNA shRNA Plasmid DNA
pleckstrin homology-like domain, family B, member 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000159507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198850.2-1351s1c1
Sequence:CCGGCCTGAATATTTCATGAGCATTCTCGAGAATGCTCATGAAATATTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198850.2-1277s1c1
Sequence:CCGGGCCTGTCATGTTCTTCTGAATCTCGAGATTCAGAAGAACATGACAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198850.2-1024s1c1
Sequence:CCGGGATGAGGGAACAACTGGATGTCTCGAGACATCCAGTTGTTCCCTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198850.2-524s1c1
Sequence:CCGGGAGGAAGAAGAAGTGGGAGAACTCGAGTTCTCCCACTTCTTCTTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198850.2-1833s1c1
Sequence:CCGGCCACCACATTCTTTGCCTCTACTCGAGTAGAGGCAAAGAATGTGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198850.2-1022s1c1
Sequence:CCGGGAGATGAGGGAACAACTGGATCTCGAGATCCAGTTGTTCCCTCATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198850.2-1713s1c1
Sequence:CCGGCCTGGTCTTAAACTCTTGGATCTCGAGATCCAAGAGTTTAAGACCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198850.2-1756s1c1
Sequence:CCGGCCTTTCAAGATGCTGGGATTACTCGAGTAATCCCAGCATCTTGAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198850
PHLDB3 MISSION shRNA Lentiviral Transduction Particles
pleckstrin homology-like domain, family B, member 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000159507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198850.2-1351s1c1
Sequence:CCGGCCTGAATATTTCATGAGCATTCTCGAGAATGCTCATGAAATATTCAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198850.2-1277s1c1
Sequence:CCGGGCCTGTCATGTTCTTCTGAATCTCGAGATTCAGAAGAACATGACAGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198850.2-1024s1c1
Sequence:CCGGGATGAGGGAACAACTGGATGTCTCGAGACATCCAGTTGTTCCCTCATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198850.2-524s1c1
Sequence:CCGGGAGGAAGAAGAAGTGGGAGAACTCGAGTTCTCCCACTTCTTCTTCCTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198850.2-1833s1c1
Sequence:CCGGCCACCACATTCTTTGCCTCTACTCGAGTAGAGGCAAAGAATGTGGTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198850.2-1022s1c1
Sequence:CCGGGAGATGAGGGAACAACTGGATCTCGAGATCCAGTTGTTCCCTCATCTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198850.2-1713s1c1
Sequence:CCGGCCTGGTCTTAAACTCTTGGATCTCGAGATCCAAGAGTTTAAGACCAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198850.2-1756s1c1
Sequence:CCGGCCTTTCAAGATGCTGGGATTACTCGAGTAATCCCAGCATCTTGAAAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)