EMAIL THIS PAGE TO A FRIEND

PHLPP1

PH domain and leucine rich repeat protein phosphatase 1

96 Gene Product Result for
Synonyms: PHLPP PLEKHE1 SCOP
Gene ID:
Human(23239) Summary: This gene encodes a member of the serine/threonine phosphatase family. The encoded protein promotes apoptosis by dephosphorylating and inactivating the serine/threonine kinase Akt, and functions as a tumor suppressor in multiple types of cancer. Increased expression of this gene may also play a role in obesity and type 2 diabetes by interfering with Akt-mediated insulin signaling. [provided by RefSeq, Dec 2011]
Mouse(98432) PH domain and leucine rich repeat protein phosphatase 1
Rat(59265) PH domain and leucine rich repeat protein phosphatase 1
chicken(420904) PH domain and leucine rich repeat protein phosphatase 1
Horse(100057142) PH domain and leucine rich repeat protein phosphatase 1
domestic cat(101091156) PH domain and leucine rich repeat protein phosphatase 1
dog(476179) PH domain and leucine rich repeat protein phosphatase 1
cow(615982) PH domain and leucine rich repeat protein phosphatase 1
domestic guinea pig(100723560) PH domain and leucine rich repeat protein phosphatase 1
naked mole-rat(101701316) PH domain and leucine rich repeat protein phosphatase 1
Gene Class: Apoptosis
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_194449 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_194449 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_194449 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_129968 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_129968 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_129968 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU009811 MISSION® esiRNA esiRNA targeting human PHLPP (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_194449 Rosetta Predictions human pricing
NM_021657 Rosetta Predictions rat pricing
XM_001475839 Rosetta Predictions mouse pricing
XM_129968 Rosetta Predictions mouse pricing
XM_900133 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_194449 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00159083 predicted 1156
2 SASI_Hs01_00159085 predicted 1266
3 SASI_Hs01_00159086 predicted 1117
4 SASI_Hs01_00159087 predicted 711
5 SASI_Hs01_00159088 predicted 3225
6 SASI_Hs01_00159089 predicted 262
7 SASI_Hs01_00159090 predicted 1221
8 SASI_Hs01_00159091 predicted 1672
9 SASI_Hs01_00159092 predicted 505
10 SASI_Hs02_00371525 predicted 1718
11 SASI_Hs01_00159084 predicted 1170
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021657 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00045974 predicted 3652
2 SASI_Rn02_00262652 predicted 2010
3 SASI_Rn02_00262653 predicted 2121
4 SASI_Rn01_00045975 predicted 1976
5 SASI_Rn01_00045977 predicted 3073
6 SASI_Rn01_00045978 predicted 2591
7 SASI_Rn01_00045979 predicted 1757
8 SASI_Rn02_00262654 predicted 1811
9 SASI_Rn01_00045980 predicted 3113
10 SASI_Rn01_00045981 predicted 3528
11 SASI_Rn01_00045976 predicted 3309
12 SASI_Rn01_00045982 predicted 2955
13 SASI_Rn01_00045983 predicted 2932
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001475839 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00385272 predicted 2553
2 SASI_Mm02_00385273 predicted 3454
3 SASI_Mm02_00385274 predicted 2797
4 SASI_Mm02_00385275 predicted 1489
5 SASI_Mm02_00385276 predicted 2545
6 SASI_Mm02_00385277 predicted 2746
7 SASI_Mm02_00385278 predicted 3129
8 SASI_Mm02_00385279 predicted 2037
9 SASI_Mm02_00385280 predicted 2925
10 SASI_Mm02_00385281 predicted 3210
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_129968 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00285619 predicted 2682
2 SASI_Mm01_00285620 predicted 2509
3 SASI_Mm01_00285621 predicted 3574
4 SASI_Mm01_00285622 predicted 2926
5 SASI_Mm01_00285623 predicted 2813
6 SASI_Mm01_00285624 predicted 2675
7 SASI_Mm01_00285625 predicted 2875
8 SASI_Mm01_00285626 predicted 3255
9 SASI_Mm01_00285627 predicted 3061
10 SASI_Mm01_00285628 predicted 4796
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900133 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00215503 predicted 210
2 SASI_Mm01_00215504 predicted 245
3 SASI_Mm01_00215505 predicted 197
4 SASI_Mm01_00215506 predicted 242
5 SASI_Mm01_00215507 predicted 236
6 SASI_Mm01_00215508 predicted 248
7 SASI_Mm01_00215509 predicted 220
8 SASI_Mm01_00215510 predicted 235
9 SASI_Mm01_00215511 predicted 237
10 SASI_Mm01_00215512 predicted 205
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_194449
VALIDATED
PHLPP1 MISSION shRNA Bacterial Glycerol Stock
PH domain and leucine rich repeat protein phosphatase 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000082794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_194449.1-346s1c1
Sequence:CCGGCCTGATAGTATCATCTGTGAACTCGAGTTCACAGATGATACTATCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194449.1-1927s21c1
Sequence:CCGGCGAGGTCTTTCCCGAAGTTATCTCGAGATAACTTCGGGAAAGACCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194449.1-2434s1c1
Sequence:CCGGCGCTGTCCTTTGTCATATCAACTCGAGTTGATATGACAAAGGACAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082793    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_194449.1-3802s1c1
Sequence:CCGGCCGAGCTGTTTAACAAATAAACTCGAGTTTATTTGTTAAACAGCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194449.1-475s1c1
Sequence:CCGGCCAGACTTACTACATTTGCTTCTCGAGAAGCAAATGTAGTAAGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194449.1-1927s1c1
Sequence:CCGGCGAGGTCTTTCCCGAAGTTATCTCGAGATAACTTCGGGAAAGACCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194449.1-3759s21c1
Sequence:CCGGTGGACCAGCTGCCAGATTATTCTCGAGAATAATCTGGCAGCTGGTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194449.1-1433s21c1
Sequence:CCGGGAACTTCCTGCCCGCTTATTTCTCGAGAAATAAGCGGGCAGGAAGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194449.1-475s21c1
Sequence:CCGGCCAGACTTACTACATTTGCTTCTCGAGAAGCAAATGTAGTAAGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194449.1-1759s21c1
Sequence:CCGGGATCCTTCACATGGCCTATAACTCGAGTTATAGGCCATGTGAAGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363575    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_194449.1-3802s21c1
Sequence:CCGGCCGAGCTGTTTAACAAATAAACTCGAGTTTATTTGTTAAACAGCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418933    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_194449.1-4153s21c1
Sequence:CCGGTGCCGTTGCTAAATGATTTAACTCGAGTTAAATCATTTAGCAACGGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_194449
VALIDATED
PHLPP1 MISSION shRNA shRNA Plasmid DNA
PH domain and leucine rich repeat protein phosphatase 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000082794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_194449.1-346s1c1
Sequence:CCGGCCTGATAGTATCATCTGTGAACTCGAGTTCACAGATGATACTATCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194449.1-1927s21c1
Sequence:CCGGCGAGGTCTTTCCCGAAGTTATCTCGAGATAACTTCGGGAAAGACCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194449.1-2434s1c1
Sequence:CCGGCGCTGTCCTTTGTCATATCAACTCGAGTTGATATGACAAAGGACAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082793    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_194449.1-3802s1c1
Sequence:CCGGCCGAGCTGTTTAACAAATAAACTCGAGTTTATTTGTTAAACAGCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194449.1-475s1c1
Sequence:CCGGCCAGACTTACTACATTTGCTTCTCGAGAAGCAAATGTAGTAAGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194449.1-1927s1c1
Sequence:CCGGCGAGGTCTTTCCCGAAGTTATCTCGAGATAACTTCGGGAAAGACCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000377401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194449.1-3759s21c1
Sequence:CCGGTGGACCAGCTGCCAGATTATTCTCGAGAATAATCTGGCAGCTGGTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194449.1-1433s21c1
Sequence:CCGGGAACTTCCTGCCCGCTTATTTCTCGAGAAATAAGCGGGCAGGAAGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194449.1-475s21c1
Sequence:CCGGCCAGACTTACTACATTTGCTTCTCGAGAAGCAAATGTAGTAAGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194449.1-1759s21c1
Sequence:CCGGGATCCTTCACATGGCCTATAACTCGAGTTATAGGCCATGTGAAGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363575    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_194449.1-3802s21c1
Sequence:CCGGCCGAGCTGTTTAACAAATAAACTCGAGTTTATTTGTTAAACAGCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418933    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_194449.1-4153s21c1
Sequence:CCGGTGCCGTTGCTAAATGATTTAACTCGAGTTAAATCATTTAGCAACGGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_194449
VALIDATED
PHLPP1 MISSION shRNA Lentiviral Transduction Particles
PH domain and leucine rich repeat protein phosphatase 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000082794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_194449.1-346s1c1
Sequence:CCGGCCTGATAGTATCATCTGTGAACTCGAGTTCACAGATGATACTATCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194449.1-1927s21c1
Sequence:CCGGCGAGGTCTTTCCCGAAGTTATCTCGAGATAACTTCGGGAAAGACCTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194449.1-2434s1c1
Sequence:CCGGCGCTGTCCTTTGTCATATCAACTCGAGTTGATATGACAAAGGACAGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082793    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_194449.1-3802s1c1
Sequence:CCGGCCGAGCTGTTTAACAAATAAACTCGAGTTTATTTGTTAAACAGCTCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194449.1-475s1c1
Sequence:CCGGCCAGACTTACTACATTTGCTTCTCGAGAAGCAAATGTAGTAAGTCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194449.1-1927s1c1
Sequence:CCGGCGAGGTCTTTCCCGAAGTTATCTCGAGATAACTTCGGGAAAGACCTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000377401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194449.1-3759s21c1
Sequence:CCGGTGGACCAGCTGCCAGATTATTCTCGAGAATAATCTGGCAGCTGGTCCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194449.1-1433s21c1
Sequence:CCGGGAACTTCCTGCCCGCTTATTTCTCGAGAAATAAGCGGGCAGGAAGTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194449.1-475s21c1
Sequence:CCGGCCAGACTTACTACATTTGCTTCTCGAGAAGCAAATGTAGTAAGTCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194449.1-1759s21c1
Sequence:CCGGGATCCTTCACATGGCCTATAACTCGAGTTATAGGCCATGTGAAGGATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363575    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_194449.1-3802s21c1
Sequence:CCGGCCGAGCTGTTTAACAAATAAACTCGAGTTTATTTGTTAAACAGCTCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418933    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_194449.1-4153s21c1
Sequence:CCGGTGCCGTTGCTAAATGATTTAACTCGAGTTAAATCATTTAGCAACGGCATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_129968
VALIDATED
PHLPP1 MISSION shRNA Bacterial Glycerol Stock
PH domain and leucine rich repeat protein phosphatase 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000081358    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_129968.2-4487s1c1
Sequence:CCGGCCCTAACATATCAACTGTGTACTCGAGTACACAGTTGATATGTTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:XM_129968.2-2636s1c1
Sequence:CCGGCGCAGCCCTGTCTGTAAATAACTCGAGTTATTTACAGACAGGGCTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129968.2-686s1c1
Sequence:CCGGCGGAATGTACAATGTCCGAAACTCGAGTTTCGGACATTGTACATTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129968.2-1127s1c1
Sequence:CCGGGCAAAGGTTCACCAAATTGAACTCGAGTTCAATTTGGTGAACCTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129968.2-2516s1c1
Sequence:CCGGGCTCAATAACATTCGCTGCTTCTCGAGAAGCAGCGAATGTTATTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_129968.4-2602s21c1
Sequence:CCGGTTGAACGTTTGTGGCTATTTCCTCGAGGAAATAGCCACAAACGTTCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_129968.4-2668s21c1
Sequence:CCGGGTCTACCCAGTTCCGAATTATCTCGAGATAATTCGGAACTGGGTAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_129968.4-1902s21c1
Sequence:CCGGGGTTGCATCACAGCGTATAAGCTCGAGCTTATACGCTGTGATGCAACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238470    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:XM_129968.4-5799s21c1
Sequence:CCGGCATAAGGACACAGCCTAAATACTCGAGTATTTAGGCTGTGTCCTTATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_129968
VALIDATED
PHLPP1 MISSION shRNA shRNA Plasmid DNA
PH domain and leucine rich repeat protein phosphatase 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000081358    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_129968.2-4487s1c1
Sequence:CCGGCCCTAACATATCAACTGTGTACTCGAGTACACAGTTGATATGTTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:XM_129968.2-2636s1c1
Sequence:CCGGCGCAGCCCTGTCTGTAAATAACTCGAGTTATTTACAGACAGGGCTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129968.2-686s1c1
Sequence:CCGGCGGAATGTACAATGTCCGAAACTCGAGTTTCGGACATTGTACATTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129968.2-1127s1c1
Sequence:CCGGGCAAAGGTTCACCAAATTGAACTCGAGTTCAATTTGGTGAACCTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129968.2-2516s1c1
Sequence:CCGGGCTCAATAACATTCGCTGCTTCTCGAGAAGCAGCGAATGTTATTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_129968.4-2602s21c1
Sequence:CCGGTTGAACGTTTGTGGCTATTTCCTCGAGGAAATAGCCACAAACGTTCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_129968.4-2668s21c1
Sequence:CCGGGTCTACCCAGTTCCGAATTATCTCGAGATAATTCGGAACTGGGTAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_129968.4-1902s21c1
Sequence:CCGGGGTTGCATCACAGCGTATAAGCTCGAGCTTATACGCTGTGATGCAACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238470    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:XM_129968.4-5799s21c1
Sequence:CCGGCATAAGGACACAGCCTAAATACTCGAGTATTTAGGCTGTGTCCTTATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_129968
VALIDATED
PHLPP1 MISSION shRNA Lentiviral Transduction Particles
PH domain and leucine rich repeat protein phosphatase 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000081358    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_129968.2-4487s1c1
Sequence:CCGGCCCTAACATATCAACTGTGTACTCGAGTACACAGTTGATATGTTAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:XM_129968.2-2636s1c1
Sequence:CCGGCGCAGCCCTGTCTGTAAATAACTCGAGTTATTTACAGACAGGGCTGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129968.2-686s1c1
Sequence:CCGGCGGAATGTACAATGTCCGAAACTCGAGTTTCGGACATTGTACATTCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129968.2-1127s1c1
Sequence:CCGGGCAAAGGTTCACCAAATTGAACTCGAGTTCAATTTGGTGAACCTTTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129968.2-2516s1c1
Sequence:CCGGGCTCAATAACATTCGCTGCTTCTCGAGAAGCAGCGAATGTTATTGAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_129968.4-2602s21c1
Sequence:CCGGTTGAACGTTTGTGGCTATTTCCTCGAGGAAATAGCCACAAACGTTCAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_129968.4-2668s21c1
Sequence:CCGGGTCTACCCAGTTCCGAATTATCTCGAGATAATTCGGAACTGGGTAGACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_129968.4-1902s21c1
Sequence:CCGGGGTTGCATCACAGCGTATAAGCTCGAGCTTATACGCTGTGATGCAACCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238470    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:XM_129968.4-5799s21c1
Sequence:CCGGCATAAGGACACAGCCTAAATACTCGAGTATTTAGGCTGTGTCCTTATGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)