EMAIL THIS PAGE TO A FRIEND

PHOSPHO1

phosphatase, orphan 1

62 Gene Product Result for
UniProtKB ID: Q8TCT1, E9PAM0, Q17RU6
Gene ID:
Mouse(237928) phosphatase, orphan 1
Rat(287644) phosphatase, orphan 1
Zebrafish(100002812) phosphatase, orphan 1
domestic cat(101095209) phosphatase, orphan 1
dog(491069) phosphatase, orphan 1
chicken(395650) phosphatase, orphan 1
cow(524639) phosphatase, orphan 1
sheep(101112333) phosphatase, orphan 1
domestic guinea pig(100717176) phosphatase, orphan 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178500 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178500 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178500 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153104 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153104 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153104 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178500 Rosetta Predictions human pricing
NM_001105833 Rosetta Predictions rat pricing
NM_153104 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178500 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00196368 predicted 721
2 SASI_Hs01_00196369 predicted 1449
3 SASI_Hs01_00196370 predicted 1259
4 SASI_Hs01_00196371 predicted 1610
5 SASI_Hs01_00196372 predicted 804
6 SASI_Hs02_00369743 predicted 1302
7 SASI_Hs01_00196373 predicted 1251
8 SASI_Hs01_00196374 predicted 471
9 SASI_Hs01_00196375 predicted 1303
10 SASI_Hs01_00196376 predicted 570
11 SASI_Hs01_00196377 predicted 1410
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105833 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00212976 predicted 472
2 SASI_Rn02_00212977 predicted 995
3 SASI_Rn02_00212978 predicted 581
4 SASI_Rn02_00212979 predicted 1477
5 SASI_Rn02_00212980 predicted 735
6 SASI_Rn02_00212981 predicted 705
7 SASI_Rn02_00212982 predicted 1181
8 SASI_Rn02_00212983 predicted 630
9 SASI_Rn02_00212984 predicted 494
10 SASI_Rn02_00212985 predicted 1382
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153104 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00168202 predicted 450
2 SASI_Mm02_00342953 predicted 1192
3 SASI_Mm01_00168203 predicted 289
4 SASI_Mm01_00168204 predicted 615
5 SASI_Mm01_00168205 predicted 479
6 SASI_Mm01_00168206 predicted 574
7 SASI_Mm02_00342954 predicted 1371
8 SASI_Mm02_00342955 predicted 1032
9 SASI_Mm02_00342956 predicted 1057
10 SASI_Mm01_00168208 predicted 374
11 SASI_Mm01_00168201 predicted 804
12 SASI_Mm01_00168207 predicted 700
13 SASI_Mm01_00168209 predicted 883
14 SASI_Mm01_00168210 predicted 821
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178500
PHOSPHO1 MISSION shRNA Bacterial Glycerol Stock
phosphatase, orphan 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000011059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178500.2-906s1c1
Sequence:CCGGCGCCAACATGTGCAAGCACAACTCGAGTTGTGCTTGCACATGTTGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368675    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178500.3-1329s21c1
Sequence:CCGGTCAGAGCCGTCCCTATCTATTCTCGAGAATAGATAGGGACGGCTCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178500.3-728s21c1
Sequence:CCGGTCTCCGATGCCAACACCTTTGCTCGAGCAAAGGTGTTGGCATCGGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178500.2-491s1c1
Sequence:CCGGACGAGACTATCGTGGACGAAACTCGAGTTTCGTCCACGATAGTCTCGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178500.2-739s1c1
Sequence:CCGGGAGGTGATTCTCATCTCCGATCTCGAGATCGGAGATGAGAATCACCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006968    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178500.2-1360s1c1
Sequence:CCGGCGTCCCTATCTATTCAGTTAACTCGAGTTAACTGAATAGATAGGGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178500.2-480s1c1
Sequence:CCGGCTTCGACTTCGACGAGACTATCTCGAGATAGTCTCGTCGAAGTCGAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178500.3-457s21c1
Sequence:CCGGTTCGACTTCGACGAGACTATCCTCGAGGATAGTCTCGTCGAAGTCGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355777    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178500.3-1287s21c1
Sequence:CCGGGAATTTCTGGAATCTCGTATTCTCGAGAATACGAGATTCCAGAAATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178500
PHOSPHO1 MISSION shRNA shRNA Plasmid DNA
phosphatase, orphan 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000011059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178500.2-906s1c1
Sequence:CCGGCGCCAACATGTGCAAGCACAACTCGAGTTGTGCTTGCACATGTTGGCGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000368675    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178500.3-1329s21c1
Sequence:CCGGTCAGAGCCGTCCCTATCTATTCTCGAGAATAGATAGGGACGGCTCTGATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000368626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178500.3-728s21c1
Sequence:CCGGTCTCCGATGCCAACACCTTTGCTCGAGCAAAGGTGTTGGCATCGGAGATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000006970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178500.2-491s1c1
Sequence:CCGGACGAGACTATCGTGGACGAAACTCGAGTTTCGTCCACGATAGTCTCGTTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000006969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178500.2-739s1c1
Sequence:CCGGGAGGTGATTCTCATCTCCGATCTCGAGATCGGAGATGAGAATCACCTCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000006968    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178500.2-1360s1c1
Sequence:CCGGCGTCCCTATCTATTCAGTTAACTCGAGTTAACTGAATAGATAGGGACGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000006971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178500.2-480s1c1
Sequence:CCGGCTTCGACTTCGACGAGACTATCTCGAGATAGTCTCGTCGAAGTCGAAGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000368432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178500.3-457s21c1
Sequence:CCGGTTCGACTTCGACGAGACTATCCTCGAGGATAGTCTCGTCGAAGTCGAATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000355777    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178500.3-1287s21c1
Sequence:CCGGGAATTTCTGGAATCTCGTATTCTCGAGAATACGAGATTCCAGAAATTCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178500
PHOSPHO1 MISSION shRNA Lentiviral Transduction Particles
phosphatase, orphan 1
Human
9 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000011059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178500.2-906s1c1
Sequence:CCGGCGCCAACATGTGCAAGCACAACTCGAGTTGTGCTTGCACATGTTGGCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000368675    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178500.3-1329s21c1
Sequence:CCGGTCAGAGCCGTCCCTATCTATTCTCGAGAATAGATAGGGACGGCTCTGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000368626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178500.3-728s21c1
Sequence:CCGGTCTCCGATGCCAACACCTTTGCTCGAGCAAAGGTGTTGGCATCGGAGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178500.2-491s1c1
Sequence:CCGGACGAGACTATCGTGGACGAAACTCGAGTTTCGTCCACGATAGTCTCGTTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178500.2-739s1c1
Sequence:CCGGGAGGTGATTCTCATCTCCGATCTCGAGATCGGAGATGAGAATCACCTCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006968    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178500.2-1360s1c1
Sequence:CCGGCGTCCCTATCTATTCAGTTAACTCGAGTTAACTGAATAGATAGGGACGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178500.2-480s1c1
Sequence:CCGGCTTCGACTTCGACGAGACTATCTCGAGATAGTCTCGTCGAAGTCGAAGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000368432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178500.3-457s21c1
Sequence:CCGGTTCGACTTCGACGAGACTATCCTCGAGGATAGTCTCGTCGAAGTCGAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355777    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178500.3-1287s21c1
Sequence:CCGGGAATTTCTGGAATCTCGTATTCTCGAGAATACGAGATTCCAGAAATTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153104
PHOSPHO1 MISSION shRNA Bacterial Glycerol Stock
phosphatase, orphan 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000216877    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153104.2-1373s1c1
Sequence:CCGGGAACATCTCCCACTTACTTTACTCGAGTAAAGTAAGTGGGAGATGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153104.1-508s1c1
Sequence:CCGGCGAGTCTTTAAGTACCTGGGTCTCGAGACCCAGGTACTTAAAGACTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153104.2-612s21c1
Sequence:CCGGGGCTCCTGCTTCGAGGTTATTCTCGAGAATAACCTCGAAGCAGGAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153104.1-636s1c1
Sequence:CCGGCGAGGTTATTCTCATTTCGGACTCGAGTCCGAAATGAGAATAACCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153104.1-648s1c1
Sequence:CCGGCATTTCGGATGCCAACACCTTCTCGAGAAGGTGTTGGCATCCGAAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153104.2-484s21c1
Sequence:CCGGAGTACATGCAACGAGTCTTTACTCGAGTAAAGACTCGTTGCATGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247950    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153104.2-1373s21c1
Sequence:CCGGGAACATCTCCCACTTACTTTACTCGAGTAAAGTAAGTGGGAGATGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153104.2-807s21c1
Sequence:CCGGCACAAGGTGCTCAGCGAATACCTCGAGGTATTCGCTGAGCACCTTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153104.2-873s21c1
Sequence:CCGGTACGTGGGTGATGGTGCAAATCTCGAGATTTGCACCATCACCCACGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153104
PHOSPHO1 MISSION shRNA shRNA Plasmid DNA
phosphatase, orphan 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000216877    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153104.2-1373s1c1
Sequence:CCGGGAACATCTCCCACTTACTTTACTCGAGTAAAGTAAGTGGGAGATGTTCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000183987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153104.1-508s1c1
Sequence:CCGGCGAGTCTTTAAGTACCTGGGTCTCGAGACCCAGGTACTTAAAGACTCGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000247951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153104.2-612s21c1
Sequence:CCGGGGCTCCTGCTTCGAGGTTATTCTCGAGAATAACCTCGAAGCAGGAGCCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000181184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153104.1-636s1c1
Sequence:CCGGCGAGGTTATTCTCATTTCGGACTCGAGTCCGAAATGAGAATAACCTCGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000183924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153104.1-648s1c1
Sequence:CCGGCATTTCGGATGCCAACACCTTCTCGAGAAGGTGTTGGCATCCGAAATGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000247952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153104.2-484s21c1
Sequence:CCGGAGTACATGCAACGAGTCTTTACTCGAGTAAAGACTCGTTGCATGTACTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000247950    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153104.2-1373s21c1
Sequence:CCGGGAACATCTCCCACTTACTTTACTCGAGTAAAGTAAGTGGGAGATGTTCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000247949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153104.2-807s21c1
Sequence:CCGGCACAAGGTGCTCAGCGAATACCTCGAGGTATTCGCTGAGCACCTTGTGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000257774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153104.2-873s21c1
Sequence:CCGGTACGTGGGTGATGGTGCAAATCTCGAGATTTGCACCATCACCCACGTATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153104
PHOSPHO1 MISSION shRNA Lentiviral Transduction Particles
phosphatase, orphan 1
Mouse
9 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000216877    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153104.2-1373s1c1
Sequence:CCGGGAACATCTCCCACTTACTTTACTCGAGTAAAGTAAGTGGGAGATGTTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153104.1-508s1c1
Sequence:CCGGCGAGTCTTTAAGTACCTGGGTCTCGAGACCCAGGTACTTAAAGACTCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153104.2-612s21c1
Sequence:CCGGGGCTCCTGCTTCGAGGTTATTCTCGAGAATAACCTCGAAGCAGGAGCCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153104.1-636s1c1
Sequence:CCGGCGAGGTTATTCTCATTTCGGACTCGAGTCCGAAATGAGAATAACCTCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153104.1-648s1c1
Sequence:CCGGCATTTCGGATGCCAACACCTTCTCGAGAAGGTGTTGGCATCCGAAATGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153104.2-484s21c1
Sequence:CCGGAGTACATGCAACGAGTCTTTACTCGAGTAAAGACTCGTTGCATGTACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247950    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153104.2-1373s21c1
Sequence:CCGGGAACATCTCCCACTTACTTTACTCGAGTAAAGTAAGTGGGAGATGTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153104.2-807s21c1
Sequence:CCGGCACAAGGTGCTCAGCGAATACCTCGAGGTATTCGCTGAGCACCTTGTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153104.2-873s21c1
Sequence:CCGGTACGTGGGTGATGGTGCAAATCTCGAGATTTGCACCATCACCCACGTATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)