EMAIL THIS PAGE TO A FRIEND

PHOSPHO2

phosphatase, orphan 2

40 Gene Product Result for
UniProtKB ID: Q8TCD6, B2RC30, D3DPC7
Gene ID:
Mouse(73373) phosphatase, orphan 2
Rat(295663) phosphatase, orphan 2
domestic guinea pig(100732519) phosphatase, orphan 2
naked mole-rat(101722484) phosphatase, orphan 2
cow(507308) phosphatase, orphan 2
sheep(101119113) phosphatase, orphan 2
Zebrafish(799638) phosphatase, orphan 2
domestic cat(101087253) phosphatase, orphan 2
dog(100684043) phosphatase, orphan 2
chicken(424160) phosphatase, orphan 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028521 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028521 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028521 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001008489 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001008489 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001008489 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU135471 MISSION® esiRNA targeting human PHOSPHO2 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008489 Rosetta Predictions human pricing
NM_001007642 Rosetta Predictions rat pricing
NM_028521 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008489 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00021500 predicted 618
2 SASI_Hs01_00021501 predicted 593
3 SASI_Hs01_00021502 predicted 522
4 SASI_Hs01_00021503 predicted 824
5 SASI_Hs01_00021504 predicted 473
6 SASI_Hs01_00021506 predicted 437
7 SASI_Hs01_00021507 predicted 889
8 SASI_Hs01_00021508 predicted 439
9 SASI_Hs01_00021509 predicted 548
10 SASI_Hs02_00305471 predicted 876
11 SASI_Hs01_00021505 predicted 408
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007642 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00097729 predicted 1095
2 SASI_Rn01_00097731 predicted 507
3 SASI_Rn01_00097732 predicted 1067
4 SASI_Rn01_00097733 predicted 396
5 SASI_Rn01_00097734 predicted 981
6 SASI_Rn01_00097735 predicted 673
7 SASI_Rn01_00097736 predicted 1015
8 SASI_Rn01_00097737 predicted 1166
9 SASI_Rn01_00097738 predicted 552
10 SASI_Rn02_00198757 predicted 914
11 SASI_Rn01_00097730 predicted 725
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028521 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00042375 predicted 571
2 SASI_Mm01_00042376 predicted 937
3 SASI_Mm01_00042377 predicted 1032
4 SASI_Mm01_00042378 predicted 533
5 SASI_Mm01_00042379 predicted 456
6 SASI_Mm01_00042380 predicted 561
7 SASI_Mm01_00042381 predicted 1222
8 SASI_Mm01_00042382 predicted 567
9 SASI_Mm01_00042384 predicted 1132
10 SASI_Mm02_00333989 predicted 703
11 SASI_Mm01_00042383 predicted 745
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028521
VALIDATED
PHOSPHO2 MISSION shRNA Bacterial Glycerol Stock
phosphatase, orphan 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028521.2-784s21c1
Sequence:CCGGATGTCTTTGATCACGTGTTTACTCGAGTAAACACGTGATCAAAGACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028521.1-720s1c1
Sequence:CCGGCATCATCATTTCGGATTCAAACTCGAGTTTGAATCCGAAATGATGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028521.2-683s1c1
Sequence:CCGGCAGCTTCCTGAGGATGAATAACTCGAGTTATTCATCCTCAGGAAGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028521.2-576s21c1
Sequence:CCGGTTTATGGGCAGAGTCTTTAAACTCGAGTTTAAAGACTCTGCCCATAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028521.2-720s21c1
Sequence:CCGGATCATCATTTCGGATTCAAATCTCGAGATTTGAATCCGAAATGATGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249657    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028521.2-1599s21c1
Sequence:CCGGTCTATACTAAGGATGGTTAATCTCGAGATTAACCATCCTTAGTATAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028521.2-1029s21c1
Sequence:CCGGCCACGGGAAGGATATACTTTACTCGAGTAAAGTATATCCTTCCCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028521.1-1033s1c1
Sequence:CCGGCGGGAAGGATATACTTTACATCTCGAGATGTAAAGTATATCCTTCCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028521
VALIDATED
PHOSPHO2 MISSION shRNA shRNA Plasmid DNA
phosphatase, orphan 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028521.2-784s21c1
Sequence:CCGGATGTCTTTGATCACGTGTTTACTCGAGTAAACACGTGATCAAAGACATTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000200516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028521.1-720s1c1
Sequence:CCGGCATCATCATTTCGGATTCAAACTCGAGTTTGAATCCGAAATGATGATGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000217162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028521.2-683s1c1
Sequence:CCGGCAGCTTCCTGAGGATGAATAACTCGAGTTATTCATCCTCAGGAAGCTGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000249658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028521.2-576s21c1
Sequence:CCGGTTTATGGGCAGAGTCTTTAAACTCGAGTTTAAAGACTCTGCCCATAAATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000249659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028521.2-720s21c1
Sequence:CCGGATCATCATTTCGGATTCAAATCTCGAGATTTGAATCCGAAATGATGATTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000249657    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028521.2-1599s21c1
Sequence:CCGGTCTATACTAAGGATGGTTAATCTCGAGATTAACCATCCTTAGTATAGATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000249656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028521.2-1029s21c1
Sequence:CCGGCCACGGGAAGGATATACTTTACTCGAGTAAAGTATATCCTTCCCGTGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000200968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028521.1-1033s1c1
Sequence:CCGGCGGGAAGGATATACTTTACATCTCGAGATGTAAAGTATATCCTTCCCGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028521
VALIDATED
PHOSPHO2 MISSION shRNA Lentiviral Transduction Particles
phosphatase, orphan 2
Mouse
8 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000257929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028521.2-784s21c1
Sequence:CCGGATGTCTTTGATCACGTGTTTACTCGAGTAAACACGTGATCAAAGACATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028521.1-720s1c1
Sequence:CCGGCATCATCATTTCGGATTCAAACTCGAGTTTGAATCCGAAATGATGATGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028521.2-683s1c1
Sequence:CCGGCAGCTTCCTGAGGATGAATAACTCGAGTTATTCATCCTCAGGAAGCTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028521.2-576s21c1
Sequence:CCGGTTTATGGGCAGAGTCTTTAAACTCGAGTTTAAAGACTCTGCCCATAAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028521.2-720s21c1
Sequence:CCGGATCATCATTTCGGATTCAAATCTCGAGATTTGAATCCGAAATGATGATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249657    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028521.2-1599s21c1
Sequence:CCGGTCTATACTAAGGATGGTTAATCTCGAGATTAACCATCCTTAGTATAGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028521.2-1029s21c1
Sequence:CCGGCCACGGGAAGGATATACTTTACTCGAGTAAAGTATATCCTTCCCGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028521.1-1033s1c1
Sequence:CCGGCGGGAAGGATATACTTTACATCTCGAGATGTAAAGTATATCCTTCCCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001008489
VALIDATED
PHOSPHO2 MISSION shRNA Bacterial Glycerol Stock
phosphatase, orphan 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000219881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001008489.2-804s1c1
Sequence:CCGGATCATACTCATTCTTGCAATACTCGAGTATTGCAAGAATGAGTATGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008489.1-827s1c1
Sequence:CCGGGAAAGGATATACCTTACAGAACTCGAGTTCTGTAAGGTATATCCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008489.1-714s1c1
Sequence:CCGGGATAAACAGTTACAACAGGGACTCGAGTCCCTGTTGTAACTGTTTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008489.1-293s1c1
Sequence:CCGGGATTGTACAATGTGCTCCCAACTCGAGTTGGGAGCACATTGTACAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001008489.2-622s1c1
Sequence:CCGGGGTGGAACTCTTCAACTTTATCTCGAGATAAAGTTGAAGAGTTCCACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008489.1-430s1c1
Sequence:CCGGGAGCAGTGACATCATTGCCTTCTCGAGAAGGCAATGATGTCACTGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008489.1-276s1c1
Sequence:CCGGGACAATAGTGACACTTGGATTCTCGAGAATCCAAGTGTCACTATTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001008489.1-381s1c1
Sequence:CCGGGTCTTTAAGTATTTGGGAGATCTCGAGATCTCCCAAATACTTAAAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001008489.1-321s1c1
Sequence:CCGGCTTCCTATTGAACTACGTGATCTCGAGATCACGTAGTTCAATAGGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008489.1-593s1c1
Sequence:CCGGGTTTACAAATCCAGCAGCTTTCTCGAGAAAGCTGCTGGATTTGTAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001008489
VALIDATED
PHOSPHO2 MISSION shRNA shRNA Plasmid DNA
phosphatase, orphan 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000219881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001008489.2-804s1c1
Sequence:CCGGATCATACTCATTCTTGCAATACTCGAGTATTGCAAGAATGAGTATGATTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000158984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008489.1-827s1c1
Sequence:CCGGGAAAGGATATACCTTACAGAACTCGAGTTCTGTAAGGTATATCCTTTCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000159444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008489.1-714s1c1
Sequence:CCGGGATAAACAGTTACAACAGGGACTCGAGTCCCTGTTGTAACTGTTTATCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000161676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008489.1-293s1c1
Sequence:CCGGGATTGTACAATGTGCTCCCAACTCGAGTTGGGAGCACATTGTACAATCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000219880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001008489.2-622s1c1
Sequence:CCGGGGTGGAACTCTTCAACTTTATCTCGAGATAAAGTTGAAGAGTTCCACCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000163683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008489.1-430s1c1
Sequence:CCGGGAGCAGTGACATCATTGCCTTCTCGAGAAGGCAATGATGTCACTGCTCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000159301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008489.1-276s1c1
Sequence:CCGGGACAATAGTGACACTTGGATTCTCGAGAATCCAAGTGTCACTATTGTCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000158840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001008489.1-381s1c1
Sequence:CCGGGTCTTTAAGTATTTGGGAGATCTCGAGATCTCCCAAATACTTAAAGACTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000159990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001008489.1-321s1c1
Sequence:CCGGCTTCCTATTGAACTACGTGATCTCGAGATCACGTAGTTCAATAGGAAGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000159808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008489.1-593s1c1
Sequence:CCGGGTTTACAAATCCAGCAGCTTTCTCGAGAAAGCTGCTGGATTTGTAAACTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001008489
VALIDATED
PHOSPHO2 MISSION shRNA Lentiviral Transduction Particles
phosphatase, orphan 2
Human
10 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000219881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001008489.2-804s1c1
Sequence:CCGGATCATACTCATTCTTGCAATACTCGAGTATTGCAAGAATGAGTATGATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008489.1-827s1c1
Sequence:CCGGGAAAGGATATACCTTACAGAACTCGAGTTCTGTAAGGTATATCCTTTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008489.1-714s1c1
Sequence:CCGGGATAAACAGTTACAACAGGGACTCGAGTCCCTGTTGTAACTGTTTATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008489.1-293s1c1
Sequence:CCGGGATTGTACAATGTGCTCCCAACTCGAGTTGGGAGCACATTGTACAATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001008489.2-622s1c1
Sequence:CCGGGGTGGAACTCTTCAACTTTATCTCGAGATAAAGTTGAAGAGTTCCACCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008489.1-430s1c1
Sequence:CCGGGAGCAGTGACATCATTGCCTTCTCGAGAAGGCAATGATGTCACTGCTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008489.1-276s1c1
Sequence:CCGGGACAATAGTGACACTTGGATTCTCGAGAATCCAAGTGTCACTATTGTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001008489.1-381s1c1
Sequence:CCGGGTCTTTAAGTATTTGGGAGATCTCGAGATCTCCCAAATACTTAAAGACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001008489.1-321s1c1
Sequence:CCGGCTTCCTATTGAACTACGTGATCTCGAGATCACGTAGTTCAATAGGAAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008489.1-593s1c1
Sequence:CCGGGTTTACAAATCCAGCAGCTTTCTCGAGAAAGCTGCTGGATTTGTAAACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)