EMAIL THIS PAGE TO A FRIEND

PHOX2A

paired-like homeobox 2a

52 Gene Product Result for
Synonyms: ARIX CFEOM2 FEOM2 NCAM2 PMX2A
UniProtKB ID: O14813, A8K3N0, Q8IVZ2
Gene ID:
Human(401) Summary: The protein encoded by this gene contains a paired-like homeodomain most similar to that of the Drosophila aristaless gene product. The encoded protein plays a central role in development of the autonomic nervous system. It regulates the expression of tyrosine hydroxylase and dopamine beta-hydroxylase, two catecholaminergic biosynthetic enzymes essential for the differentiation and maintenance of the noradrenergic neurotransmitter phenotype. The encoded protein has also been shown to regulate transcription of the alpha3 nicotinic acetylcholine receptor gene. Mutations in this gene have been associated with autosomal recessive congenital fibrosis of the extraocular muscles. [provided by RefSeq, Jul 2008]
Mouse(11859) paired-like homeobox 2a
Rat(116648) paired-like homeobox 2a
Zebrafish(404602) paired-like homeobox 2a
chicken(395595) paired-like homeobox 2a
dog(485208) paired-like homeobox 2a
domestic cat(101095370) paired-like homeobox 2a
cow(507670) paired-like homeobox 2a
sheep(101103348) paired-like homeobox 2a
naked mole-rat(101698435) paired-like homeobox 2a
domestic guinea pig(100732349) paired-like homeobox 2a
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008887 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008887 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008887 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005169 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005169 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005169 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU000141 MISSION® esiRNA esiRNA targeting mouse Phox2a (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005169 Rosetta Predictions human pricing
NM_053869 Rosetta Predictions rat pricing
NM_008887 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005169 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00223863 predicted 1278
2 SASI_Hs01_00223864 predicted 1313
3 SASI_Hs01_00223865 predicted 385
4 SASI_Hs01_00223866 predicted 1332
5 SASI_Hs01_00223867 predicted 1322
6 SASI_Hs01_00223868 predicted 1319
7 SASI_Hs01_00223869 predicted 371
8 SASI_Hs02_00339116 predicted 1279
9 SASI_Hs01_00223871 predicted 1223
10 SASI_Hs02_00339117 predicted 1285
11 SASI_Hs01_00223870 predicted 1113
12 SASI_Hs01_00223872 predicted 1324
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053869 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00101634 predicted 401
2 SASI_Rn01_00101635 predicted 611
3 SASI_Rn01_00101637 predicted 1079
4 SASI_Rn02_00266758 predicted 534
5 SASI_Rn01_00101640 predicted 1206
6 SASI_Rn02_00266759 predicted 1158
7 SASI_Rn02_00266760 predicted 537
8 SASI_Rn01_00101642 predicted 1296
9 SASI_Rn01_00101643 predicted 1033
10 SASI_Rn02_00266761 predicted 1276
11 SASI_Rn01_00101636 predicted 1107
12 SASI_Rn01_00101638 predicted 1025
13 SASI_Rn01_00101639 predicted 1261
14 SASI_Rn01_00101641 predicted 511
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008887 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00044169 predicted 1243
2 SASI_Mm01_00044170 predicted 1196
3 SASI_Mm01_00044171 predicted 382
4 SASI_Mm01_00044172 predicted 1021
5 SASI_Mm01_00044173 predicted 1249
6 SASI_Mm01_00044174 predicted 539
7 SASI_Mm01_00044175 predicted 1196
8 SASI_Mm01_00044176 predicted 529
9 SASI_Mm01_00044177 predicted 401
10 SASI_Mm01_00044178 predicted 1269
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008887
PHOX2A MISSION shRNA Bacterial Glycerol Stock
paired-like homeobox 2a
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430275    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008887.2-1202s21c1
Sequence:CCGGACTCTGGTCTGGAGTACTAATCTCGAGATTAGTACTCCAGACCAGAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008887.2-462s21c1
Sequence:CCGGATCCGCACAACGTTCACGAGTCTCGAGACTCGTGAACGTTGTGCGGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008887.1-373s1c1
Sequence:CCGGGACATTTACACTCGCGAGGAACTCGAGTTCCTCGCGAGTGTAAATGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070463    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008887.1-1157s1c1
Sequence:CCGGCCCAATCATAAAGGGTCCTAACTCGAGTTAGGACCCTTTATGATTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008887.1-796s1c1
Sequence:CCGGCCAGGTCCCTTCTCTGGAGTTCTCGAGAACTCCAGAGAAGGGACCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008887.1-687s1c1
Sequence:CCGGCCAGCCGCTCAAGGGAGCGTTCTCGAGAACGCTCCCTTGAGCGGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008887.1-226s1c1
Sequence:CCGGCCCGCACCCTACTCGGCAGTTCTCGAGAACTGCCGAGTAGGGTGCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008887
PHOX2A MISSION shRNA shRNA Plasmid DNA
paired-like homeobox 2a
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430275    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008887.2-1202s21c1
Sequence:CCGGACTCTGGTCTGGAGTACTAATCTCGAGATTAGTACTCCAGACCAGAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008887.2-462s21c1
Sequence:CCGGATCCGCACAACGTTCACGAGTCTCGAGACTCGTGAACGTTGTGCGGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008887.1-373s1c1
Sequence:CCGGGACATTTACACTCGCGAGGAACTCGAGTTCCTCGCGAGTGTAAATGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070463    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008887.1-1157s1c1
Sequence:CCGGCCCAATCATAAAGGGTCCTAACTCGAGTTAGGACCCTTTATGATTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008887.1-796s1c1
Sequence:CCGGCCAGGTCCCTTCTCTGGAGTTCTCGAGAACTCCAGAGAAGGGACCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008887.1-687s1c1
Sequence:CCGGCCAGCCGCTCAAGGGAGCGTTCTCGAGAACGCTCCCTTGAGCGGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008887.1-226s1c1
Sequence:CCGGCCCGCACCCTACTCGGCAGTTCTCGAGAACTGCCGAGTAGGGTGCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008887
PHOX2A MISSION shRNA Lentiviral Transduction Particles
paired-like homeobox 2a
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430275    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008887.2-1202s21c1
Sequence:CCGGACTCTGGTCTGGAGTACTAATCTCGAGATTAGTACTCCAGACCAGAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008887.2-462s21c1
Sequence:CCGGATCCGCACAACGTTCACGAGTCTCGAGACTCGTGAACGTTGTGCGGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008887.1-373s1c1
Sequence:CCGGGACATTTACACTCGCGAGGAACTCGAGTTCCTCGCGAGTGTAAATGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070463    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008887.1-1157s1c1
Sequence:CCGGCCCAATCATAAAGGGTCCTAACTCGAGTTAGGACCCTTTATGATTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008887.1-796s1c1
Sequence:CCGGCCAGGTCCCTTCTCTGGAGTTCTCGAGAACTCCAGAGAAGGGACCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008887.1-687s1c1
Sequence:CCGGCCAGCCGCTCAAGGGAGCGTTCTCGAGAACGCTCCCTTGAGCGGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008887.1-226s1c1
Sequence:CCGGCCCGCACCCTACTCGGCAGTTCTCGAGAACTGCCGAGTAGGGTGCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005169
PHOX2A MISSION shRNA Bacterial Glycerol Stock
paired-like homeobox 2a
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000412631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005169.3-517s21c1
Sequence:CCGGCGACATTTACACGCGTGAGGACTCGAGTCCTCACGCGTGTAAATGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428870    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005169.3-1222s21c1
Sequence:CCGGCCAGCAGAGCGGAGTTCTTTACTCGAGTAAAGAACTCCGCTCTGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013543    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005169.2-1260s1c1
Sequence:CCGGCCTTCTAGCTTGGCCTTCTTTCTCGAGAAAGAAGGCCAAGCTAGAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005169.2-526s1c1
Sequence:CCGGGCGCTCAAGATCGACCTCACTCTCGAGAGTGAGGTCGATCTTGAGCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005169.2-896s1c1
Sequence:CCGGCGGCCGAACTACTTAAGGCTTCTCGAGAAGCCTTAAGTAGTTCGGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005169.2-987s1c1
Sequence:CCGGCGCCCTGAAGACCAATCTCTTCTCGAGAAGAGATTGGTCTTCAGGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005169.2-208s1c1
Sequence:CCGGGCGTCCGCCTACGGCGACTTTCTCGAGAAAGTCGCCGTAGGCGGACGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005169
PHOX2A MISSION shRNA shRNA Plasmid DNA
paired-like homeobox 2a
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000412631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005169.3-517s21c1
Sequence:CCGGCGACATTTACACGCGTGAGGACTCGAGTCCTCACGCGTGTAAATGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428870    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005169.3-1222s21c1
Sequence:CCGGCCAGCAGAGCGGAGTTCTTTACTCGAGTAAAGAACTCCGCTCTGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013543    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005169.2-1260s1c1
Sequence:CCGGCCTTCTAGCTTGGCCTTCTTTCTCGAGAAAGAAGGCCAAGCTAGAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005169.2-526s1c1
Sequence:CCGGGCGCTCAAGATCGACCTCACTCTCGAGAGTGAGGTCGATCTTGAGCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005169.2-896s1c1
Sequence:CCGGCGGCCGAACTACTTAAGGCTTCTCGAGAAGCCTTAAGTAGTTCGGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005169.2-987s1c1
Sequence:CCGGCGCCCTGAAGACCAATCTCTTCTCGAGAAGAGATTGGTCTTCAGGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005169.2-208s1c1
Sequence:CCGGGCGTCCGCCTACGGCGACTTTCTCGAGAAAGTCGCCGTAGGCGGACGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005169
PHOX2A MISSION shRNA Lentiviral Transduction Particles
paired-like homeobox 2a
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000412631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005169.3-517s21c1
Sequence:CCGGCGACATTTACACGCGTGAGGACTCGAGTCCTCACGCGTGTAAATGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428870    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005169.3-1222s21c1
Sequence:CCGGCCAGCAGAGCGGAGTTCTTTACTCGAGTAAAGAACTCCGCTCTGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013543    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005169.2-1260s1c1
Sequence:CCGGCCTTCTAGCTTGGCCTTCTTTCTCGAGAAAGAAGGCCAAGCTAGAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005169.2-526s1c1
Sequence:CCGGGCGCTCAAGATCGACCTCACTCTCGAGAGTGAGGTCGATCTTGAGCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005169.2-896s1c1
Sequence:CCGGCGGCCGAACTACTTAAGGCTTCTCGAGAAGCCTTAAGTAGTTCGGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005169.2-987s1c1
Sequence:CCGGCGCCCTGAAGACCAATCTCTTCTCGAGAAGAGATTGGTCTTCAGGGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005169.2-208s1c1
Sequence:CCGGGCGTCCGCCTACGGCGACTTTCTCGAGAAAGTCGCCGTAGGCGGACGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)