EMAIL THIS PAGE TO A FRIEND

PHOX2B

paired-like homeobox 2b

146 Gene Product Result for
Synonyms: NBLST2 NBPhox PMX2B
UniProtKB ID: Q99453, Q6PJD9
Gene ID:
Human(8929) Summary: The DNA-associated protein encoded by this gene is a member of the paired family of homeobox proteins localized to the nucleus. The protein functions as a transcription factor involved in the development of several major noradrenergic neuron populations and the determination of neurotransmitter phenotype. The gene product is linked to enhancement of second messenger-mediated activation of the dopamine beta-hydroylase, c-fos promoters and several enhancers, including cyclic amp-response element and serum-response element. [provided by RefSeq, Jul 2008]
Mouse(18935) paired-like homeobox 2b
Rat(364152) paired-like homeobox 2b
domestic guinea pig(100718867) paired-like homeobox 2b
naked mole-rat(101698856) paired-like homeobox 2b
cow(783703) paired-like homeobox 2b
sheep(101110762) paired-like homeobox 2b
chicken(395548) paired-like homeobox 2b
dog(610284) paired-like homeobox 2b
domestic cat(101093103) paired-like homeobox 2b
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003924 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003924 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003924 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008888 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008888 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008888 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003924 Rosetta Predictions human pricing
XM_001077800 Rosetta Predictions rat pricing
XM_344239 Rosetta Predictions rat pricing
NM_008888 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003924 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00065947 predicted 630
2 SASI_Hs01_00065949 predicted 596
3 SASI_Hs01_00065950 predicted 474
4 SASI_Hs01_00065952 predicted 601
5 SASI_Hs01_00065951 predicted 694
6 SASI_Hs01_00065953 predicted 1437
7 SASI_Hs02_00336574 predicted 695
8 SASI_Hs01_00065954 predicted 1268
9 SASI_Hs01_00065955 predicted 1426
10 SASI_Hs01_00065956 predicted 1263
11 SASI_Hs01_00065948 predicted 371
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077800 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00358582 predicted 242
2 SASI_Rn02_00358583 predicted 228
3 SASI_Rn02_00358584 predicted 226
4 SASI_Rn02_00358585 predicted 238
5 SASI_Rn02_00358586 predicted 194
6 SASI_Rn02_00358587 predicted 223
7 SASI_Rn02_00358588 predicted 225
8 SASI_Rn02_00358589 predicted 230
9 SASI_Rn02_00358590 predicted 236
10 SASI_Rn02_00358591 predicted 229
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_344239 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00396981 predicted 242
2 SASI_Rn02_00396982 predicted 224
3 SASI_Rn02_00396983 predicted 228
4 SASI_Rn02_00396984 predicted 234
5 SASI_Rn02_00396985 predicted 203
6 SASI_Rn02_00396986 predicted 225
7 SASI_Rn02_00396987 predicted 228
8 SASI_Rn02_00396988 predicted 231
9 SASI_Rn02_00396989 predicted 228
10 SASI_Rn02_00396990 predicted 227
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008888 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00094462 predicted 538
2 SASI_Mm01_00094464 predicted 252
3 SASI_Mm01_00094466 predicted 304
4 SASI_Mm01_00094465 predicted 422
5 SASI_Mm01_00094463 predicted 532
6 SASI_Mm01_00094468 predicted 1459
7 SASI_Mm02_00314892 predicted 193
8 SASI_Mm01_00094469 predicted 1087
9 SASI_Mm02_00314893 predicted 1461
10 SASI_Mm01_00094471 predicted 1448
11 SASI_Mm01_00094467 predicted 1101
12 SASI_Mm01_00094470 predicted 1102
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003924
PHOX2B MISSION shRNA Bacterial Glycerol Stock
paired-like homeobox 2b
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013308    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003924.2-1443s1c1
Sequence:CCGGCGCGCTAAGAATAAAGGGAAACTCGAGTTTCCCTTTATTCTTAGCGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003924.2-1278s1c1
Sequence:CCGGCGCCTTAGTGAAGAGCAGTATCTCGAGATACTGCTCTTCACTAAGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003924.2-1238s1c1
Sequence:CCGGGCGTCCTATCTTCGCTCCAAACTCGAGTTTGGAGCGAAGATAGGACGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003924.2-597s1c1
Sequence:CCGGCGCAGTTCCTTACAAACTCTTCTCGAGAAGAGTTTGTAAGGAACTGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003924.2-482s1c1
Sequence:CCGGGCTTCCAGTATAACCCGATAACTCGAGTTATCGGGTTATACTGGAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358500    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003924.3-1783s21c1
Sequence:CCGGTGGAAGGCAGAAACCATTAAACTCGAGTTTAATGGTTTCTGCCTTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003924.3-475s21c1
Sequence:CCGGGCCAGTGGCTTCCAGTATAACCTCGAGGTTATACTGGAAGCCACTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358499    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003924.3-1437s21c1
Sequence:CCGGAGTAATCGCGCTAAGAATAAACTCGAGTTTATTCTTAGCGCGATTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003924
PHOX2B MISSION shRNA shRNA Plasmid DNA
paired-like homeobox 2b
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013308    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003924.2-1443s1c1
Sequence:CCGGCGCGCTAAGAATAAAGGGAAACTCGAGTTTCCCTTTATTCTTAGCGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003924.2-1278s1c1
Sequence:CCGGCGCCTTAGTGAAGAGCAGTATCTCGAGATACTGCTCTTCACTAAGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003924.2-1238s1c1
Sequence:CCGGGCGTCCTATCTTCGCTCCAAACTCGAGTTTGGAGCGAAGATAGGACGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003924.2-597s1c1
Sequence:CCGGCGCAGTTCCTTACAAACTCTTCTCGAGAAGAGTTTGTAAGGAACTGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003924.2-482s1c1
Sequence:CCGGGCTTCCAGTATAACCCGATAACTCGAGTTATCGGGTTATACTGGAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358500    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003924.3-1783s21c1
Sequence:CCGGTGGAAGGCAGAAACCATTAAACTCGAGTTTAATGGTTTCTGCCTTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003924.3-475s21c1
Sequence:CCGGGCCAGTGGCTTCCAGTATAACCTCGAGGTTATACTGGAAGCCACTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358499    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003924.3-1437s21c1
Sequence:CCGGAGTAATCGCGCTAAGAATAAACTCGAGTTTATTCTTAGCGCGATTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003924
PHOX2B MISSION shRNA Lentiviral Transduction Particles
paired-like homeobox 2b
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013308    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003924.2-1443s1c1
Sequence:CCGGCGCGCTAAGAATAAAGGGAAACTCGAGTTTCCCTTTATTCTTAGCGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003924.2-1278s1c1
Sequence:CCGGCGCCTTAGTGAAGAGCAGTATCTCGAGATACTGCTCTTCACTAAGGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003924.2-1238s1c1
Sequence:CCGGGCGTCCTATCTTCGCTCCAAACTCGAGTTTGGAGCGAAGATAGGACGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003924.2-597s1c1
Sequence:CCGGCGCAGTTCCTTACAAACTCTTCTCGAGAAGAGTTTGTAAGGAACTGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003924.2-482s1c1
Sequence:CCGGGCTTCCAGTATAACCCGATAACTCGAGTTATCGGGTTATACTGGAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358500    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003924.3-1783s21c1
Sequence:CCGGTGGAAGGCAGAAACCATTAAACTCGAGTTTAATGGTTTCTGCCTTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003924.3-475s21c1
Sequence:CCGGGCCAGTGGCTTCCAGTATAACCTCGAGGTTATACTGGAAGCCACTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358499    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003924.3-1437s21c1
Sequence:CCGGAGTAATCGCGCTAAGAATAAACTCGAGTTTATTCTTAGCGCGATTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008888
PHOX2B MISSION shRNA Bacterial Glycerol Stock
paired-like homeobox 2b
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000096434    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008888.2-2316s1c1
Sequence:CCGGCGCAGTTTAGACATCTCTGTTCTCGAGAACAGAGATGTCTAAACTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008888.2-1063s1c1
Sequence:CCGGGCGTCTTATCTTCGCTCCAAACTCGAGTTTGGAGCGAAGATAAGACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008888.2-217s1c1
Sequence:CCGGCCTCTGCCTACGAGTCCTGTACTCGAGTACAGGACTCGTAGGCAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008888.2-455s1c1
Sequence:CCGGCGGCCTCAACGAGAAACGCAACTCGAGTTGCGTTTCTCGTTGAGGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008888.2-422s1c1
Sequence:CCGGCGCAGTTCCATACAAACTCTTCTCGAGAAGAGTTTGTATGGAACTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008888.3-255s21c1
Sequence:CCGGTCCAGCTTGGCTTCAGCATATCTCGAGATATGCTGAAGCCAAGCTGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008888.3-1104s21c1
Sequence:CCGGGCCTTAGTGAAGAGCAGTATGCTCGAGCATACTGCTCTTCACTAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417614    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008888.3-1629s21c1
Sequence:CCGGGATCCAAATGGAGGGAATAATCTCGAGATTATTCCCTCCATTTGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008888
PHOX2B MISSION shRNA shRNA Plasmid DNA
paired-like homeobox 2b
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000096434    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008888.2-2316s1c1
Sequence:CCGGCGCAGTTTAGACATCTCTGTTCTCGAGAACAGAGATGTCTAAACTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008888.2-1063s1c1
Sequence:CCGGGCGTCTTATCTTCGCTCCAAACTCGAGTTTGGAGCGAAGATAAGACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008888.2-217s1c1
Sequence:CCGGCCTCTGCCTACGAGTCCTGTACTCGAGTACAGGACTCGTAGGCAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008888.2-455s1c1
Sequence:CCGGCGGCCTCAACGAGAAACGCAACTCGAGTTGCGTTTCTCGTTGAGGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008888.2-422s1c1
Sequence:CCGGCGCAGTTCCATACAAACTCTTCTCGAGAAGAGTTTGTATGGAACTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008888.3-255s21c1
Sequence:CCGGTCCAGCTTGGCTTCAGCATATCTCGAGATATGCTGAAGCCAAGCTGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008888.3-1104s21c1
Sequence:CCGGGCCTTAGTGAAGAGCAGTATGCTCGAGCATACTGCTCTTCACTAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417614    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008888.3-1629s21c1
Sequence:CCGGGATCCAAATGGAGGGAATAATCTCGAGATTATTCCCTCCATTTGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008888
PHOX2B MISSION shRNA Lentiviral Transduction Particles
paired-like homeobox 2b
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000096434    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008888.2-2316s1c1
Sequence:CCGGCGCAGTTTAGACATCTCTGTTCTCGAGAACAGAGATGTCTAAACTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008888.2-1063s1c1
Sequence:CCGGGCGTCTTATCTTCGCTCCAAACTCGAGTTTGGAGCGAAGATAAGACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008888.2-217s1c1
Sequence:CCGGCCTCTGCCTACGAGTCCTGTACTCGAGTACAGGACTCGTAGGCAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008888.2-455s1c1
Sequence:CCGGCGGCCTCAACGAGAAACGCAACTCGAGTTGCGTTTCTCGTTGAGGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008888.2-422s1c1
Sequence:CCGGCGCAGTTCCATACAAACTCTTCTCGAGAAGAGTTTGTATGGAACTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008888.3-255s21c1
Sequence:CCGGTCCAGCTTGGCTTCAGCATATCTCGAGATATGCTGAAGCCAAGCTGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008888.3-1104s21c1
Sequence:CCGGGCCTTAGTGAAGAGCAGTATGCTCGAGCATACTGCTCTTCACTAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417614    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008888.3-1629s21c1
Sequence:CCGGGATCCAAATGGAGGGAATAATCTCGAGATTATTCCCTCCATTTGGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)