EMAIL THIS PAGE TO A FRIEND

PHPT1

phosphohistidine phosphatase 1

62 Gene Product Result for
Synonyms: CGI-202 HSPC141 PHP14 RP11-216L13.10 bA216L13.10
UniProtKB ID: Q9NRX4, B1AMX0, B1AMX1, Q9H0Y3
Gene ID:
Human(29085) Summary: PHPT1 is an EDTA-insensitive phosphohistidine phosphatase that catalyzes the dephosphorylation of phosphopeptide I (Ek et al., 2002 [PubMed 12383260]
Mouse(75454) phosphohistidine phosphatase 1
Rat(296571) phosphohistidine phosphatase 1
Zebrafish(445172) phosphohistidine phosphatase 1
chicken(770750) phosphohistidine phosphatase 1
domestic cat(101098343) phosphohistidine phosphatase 1
dog(491245) phosphohistidine phosphatase 1
cow(618691) phosphohistidine phosphatase 1
naked mole-rat(101705528) phosphohistidine phosphatase 1
domestic guinea pig(100733710) phosphohistidine phosphatase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_203853 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_203853 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_203853 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014172 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014172 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014172 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029293 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029293 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029293 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014172 siRNAs that have been validated in the lab human pricing
NM_001106558 Rosetta Predictions rat pricing
NM_029293 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014172 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00087988 validated 454
2 SASI_Hs01_00087989 predicted 499
3 SASI_Hs01_00087991 predicted 345
4 SASI_Hs01_00087992 predicted 596
5 SASI_Hs01_00087993 predicted 596
6 SASI_Hs01_00087994 predicted 460
7 SASI_Hs02_00345179 predicted 490
8 SASI_Hs01_00087995 predicted 383
9 SASI_Hs01_00087996 predicted 475
10 SASI_Hs01_00087997 predicted 448
11 SASI_Hs01_00087990 predicted 634
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106558 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00220138 predicted 270
2 SASI_Rn02_00220139 predicted 264
3 SASI_Rn02_00220140 predicted 336
4 SASI_Rn02_00220141 predicted 209
5 SASI_Rn02_00220142 predicted 235
6 SASI_Rn02_00220143 predicted 338
7 SASI_Rn02_00220144 predicted 234
8 SASI_Rn02_00220145 predicted 301
9 SASI_Rn02_00220146 predicted 260
10 SASI_Rn02_00220147 predicted 293
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029293 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00053052 predicted 521
2 SASI_Mm01_00053053 predicted 42
3 SASI_Mm01_00053054 predicted 290
4 SASI_Mm01_00053055 predicted 533
5 SASI_Mm01_00053056 predicted 227
6 SASI_Mm01_00053057 predicted 184
7 SASI_Mm01_00053058 predicted 143
8 SASI_Mm01_00053059 predicted 175
9 SASI_Mm01_00053060 predicted 94
10 SASI_Mm01_00053061 predicted 44
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_203853
VALIDATED
PHPT1 MISSION shRNA Bacterial Glycerol Stock
phosphohistidine phosphatase 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000080980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:XM_203853.3-348s1c1
Sequence:CCGGGAGAAGATCAAAGCCAAGTATCTCGAGATACTTGGCTTTGATCTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:XM_203853.3-299s1c1
Sequence:CCGGGTATGGCTACTCTATGGGTTACTCGAGTAACCCATAGAGTAGCCATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080978    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:XM_203853.3-430s1c1
Sequence:CCGGCCCGGACTAAGTCAGGTCTCTCTCGAGAGAGACCTGACTTAGTCCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:XM_203853.3-332s1c1
Sequence:CCGGGCACTCTGTTTCAACTGAGAACTCGAGTTCTCAGTTGAAACAGAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:XM_203853.3-186s1c1
Sequence:CCGGCACGCGGACATCTATGACAAACTCGAGTTTGTCATAGATGTCCGCGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_203853
VALIDATED
PHPT1 MISSION shRNA shRNA Plasmid DNA
phosphohistidine phosphatase 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000080980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:XM_203853.3-348s1c1
Sequence:CCGGGAGAAGATCAAAGCCAAGTATCTCGAGATACTTGGCTTTGATCTTCTCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000080982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:XM_203853.3-299s1c1
Sequence:CCGGGTATGGCTACTCTATGGGTTACTCGAGTAACCCATAGAGTAGCCATACTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000080978    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:XM_203853.3-430s1c1
Sequence:CCGGCCCGGACTAAGTCAGGTCTCTCTCGAGAGAGACCTGACTTAGTCCGGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000080979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:XM_203853.3-332s1c1
Sequence:CCGGGCACTCTGTTTCAACTGAGAACTCGAGTTCTCAGTTGAAACAGAGTGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000080981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:XM_203853.3-186s1c1
Sequence:CCGGCACGCGGACATCTATGACAAACTCGAGTTTGTCATAGATGTCCGCGTGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_203853
VALIDATED
PHPT1 MISSION shRNA Lentiviral Transduction Particles
phosphohistidine phosphatase 1
Mouse
5 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000080980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:XM_203853.3-348s1c1
Sequence:CCGGGAGAAGATCAAAGCCAAGTATCTCGAGATACTTGGCTTTGATCTTCTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:XM_203853.3-299s1c1
Sequence:CCGGGTATGGCTACTCTATGGGTTACTCGAGTAACCCATAGAGTAGCCATACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080978    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:XM_203853.3-430s1c1
Sequence:CCGGCCCGGACTAAGTCAGGTCTCTCTCGAGAGAGACCTGACTTAGTCCGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:XM_203853.3-332s1c1
Sequence:CCGGGCACTCTGTTTCAACTGAGAACTCGAGTTCTCAGTTGAAACAGAGTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:XM_203853.3-186s1c1
Sequence:CCGGCACGCGGACATCTATGACAAACTCGAGTTTGTCATAGATGTCCGCGTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014172
VALIDATED
PHPT1 MISSION shRNA Bacterial Glycerol Stock
phosphohistidine phosphatase 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000050659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_014172.2-387s1c1
Sequence:CCGGCGTCTTCAAGTATGTGCTGATCTCGAGATCAGCACATACTTGAAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_014172.2-504s1c1
Sequence:CCGGCGACAAAGTGTCGGGCGACATCTCGAGATGTCGCCCGACACTTTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_014172.2-468s1c1
Sequence:CCGGCGGCTACAAGTGGGCTGAGTACTCGAGTACTCAGCCCACTTGTAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_014172.2-490s1c1
Sequence:CCGGCATGCGGACATCTACGACAAACTCGAGTTTGTCGTAGATGTCCGCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014172.2-636s1c1
Sequence:CCGGGCACGCCATTTCAACTGAGAACTCGAGTTCTCAGTTGAAATGGCGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014172.4-888s21c1
Sequence:CCGGGATTCACGTGTACGGCTATTCCTCGAGGAATAGCCGTACACGTGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014172.4-868s21c1
Sequence:CCGGCACCAGAGTCAGGACAAGAAGCTCGAGCTTCTTGTCCTGACTCTGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014172
VALIDATED
PHPT1 MISSION shRNA shRNA Plasmid DNA
phosphohistidine phosphatase 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000050659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_014172.2-387s1c1
Sequence:CCGGCGTCTTCAAGTATGTGCTGATCTCGAGATCAGCACATACTTGAAGACGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000050662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_014172.2-504s1c1
Sequence:CCGGCGACAAAGTGTCGGGCGACATCTCGAGATGTCGCCCGACACTTTGTCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000050661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_014172.2-468s1c1
Sequence:CCGGCGGCTACAAGTGGGCTGAGTACTCGAGTACTCAGCCCACTTGTAGCCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000050660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_014172.2-490s1c1
Sequence:CCGGCATGCGGACATCTACGACAAACTCGAGTTTGTCGTAGATGTCCGCATGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000050658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014172.2-636s1c1
Sequence:CCGGGCACGCCATTTCAACTGAGAACTCGAGTTCTCAGTTGAAATGGCGTGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000424582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014172.4-888s21c1
Sequence:CCGGGATTCACGTGTACGGCTATTCCTCGAGGAATAGCCGTACACGTGAATCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000437698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014172.4-868s21c1
Sequence:CCGGCACCAGAGTCAGGACAAGAAGCTCGAGCTTCTTGTCCTGACTCTGGTGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014172
VALIDATED
PHPT1 MISSION shRNA Lentiviral Transduction Particles
phosphohistidine phosphatase 1
Human
7 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000050659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_014172.2-387s1c1
Sequence:CCGGCGTCTTCAAGTATGTGCTGATCTCGAGATCAGCACATACTTGAAGACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_014172.2-504s1c1
Sequence:CCGGCGACAAAGTGTCGGGCGACATCTCGAGATGTCGCCCGACACTTTGTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_014172.2-468s1c1
Sequence:CCGGCGGCTACAAGTGGGCTGAGTACTCGAGTACTCAGCCCACTTGTAGCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_014172.2-490s1c1
Sequence:CCGGCATGCGGACATCTACGACAAACTCGAGTTTGTCGTAGATGTCCGCATGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014172.2-636s1c1
Sequence:CCGGGCACGCCATTTCAACTGAGAACTCGAGTTCTCAGTTGAAATGGCGTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014172.4-888s21c1
Sequence:CCGGGATTCACGTGTACGGCTATTCCTCGAGGAATAGCCGTACACGTGAATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014172.4-868s21c1
Sequence:CCGGCACCAGAGTCAGGACAAGAAGCTCGAGCTTCTTGTCCTGACTCTGGTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029293
PHPT1 MISSION shRNA Bacterial Glycerol Stock
phosphohistidine phosphatase 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000317897    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029293.2-430s21c1
Sequence:CCGGCCCGGACTAAGTCAGGTCTCTCTCGAGAGAGACCTGACTTAGTCCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029293.2-348s21c1
Sequence:CCGGGAGAAGATCAAAGCCAAGTATCTCGAGATACTTGGCTTTGATCTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029293.2-332s21c1
Sequence:CCGGGCACTCTGTTTCAACTGAGAACTCGAGTTCTCAGTTGAAACAGAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029293.2-299s21c1
Sequence:CCGGGTATGGCTACTCTATGGGTTACTCGAGTAACCCATAGAGTAGCCATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029293
PHPT1 MISSION shRNA shRNA Plasmid DNA
phosphohistidine phosphatase 1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000317897    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029293.2-430s21c1
Sequence:CCGGCCCGGACTAAGTCAGGTCTCTCTCGAGAGAGACCTGACTTAGTCCGGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000317896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029293.2-348s21c1
Sequence:CCGGGAGAAGATCAAAGCCAAGTATCTCGAGATACTTGGCTTTGATCTTCTCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000317895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029293.2-332s21c1
Sequence:CCGGGCACTCTGTTTCAACTGAGAACTCGAGTTCTCAGTTGAAACAGAGTGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000317894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029293.2-299s21c1
Sequence:CCGGGTATGGCTACTCTATGGGTTACTCGAGTAACCCATAGAGTAGCCATACTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029293
PHPT1 MISSION shRNA Lentiviral Transduction Particles
phosphohistidine phosphatase 1
Mouse
4 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (4)? Select
TRCN0000317897    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029293.2-430s21c1
Sequence:CCGGCCCGGACTAAGTCAGGTCTCTCTCGAGAGAGACCTGACTTAGTCCGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029293.2-348s21c1
Sequence:CCGGGAGAAGATCAAAGCCAAGTATCTCGAGATACTTGGCTTTGATCTTCTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029293.2-332s21c1
Sequence:CCGGGCACTCTGTTTCAACTGAGAACTCGAGTTCTCAGTTGAAACAGAGTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029293.2-299s21c1
Sequence:CCGGGTATGGCTACTCTATGGGTTACTCGAGTAACCCATAGAGTAGCCATACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)