EMAIL THIS PAGE TO A FRIEND

PHRF1

PHD and ring finger domains 1

58 Gene Product Result for
Synonyms: RNF221
Gene ID:
Mouse(101471) PHD and ring finger domains 1
Rat(245925) PHD and ring finger domains 1
Zebrafish(321905) PHD and ring finger domains 1
chicken(426102) PHD and ring finger domains 1
dog(483405) PHD and ring finger domains 1
Horse(100055692) PHD and ring finger domains 1
domestic cat(101084318) PHD and ring finger domains 1
domestic guinea pig(100734195) PHD and ring finger domains 1
naked mole-rat(101711421) PHD and ring finger domains 1
Domestic Rabbit(100358503) PHD and ring finger domains 1
cow(100126170) PHD and ring finger domains 1
sheep(101103608) PHD and ring finger domains 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020901 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020901 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020901 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081118 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081118 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081118 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU138621 MISSION® esiRNA targeting human PHRF1 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020901 Rosetta Predictions human pricing
NM_139093 Rosetta Predictions rat pricing
NM_001081118 Rosetta Predictions mouse pricing
XM_133935 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020901 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00223383 predicted 563
2 SASI_Hs01_00223384 predicted 1435
3 SASI_Hs01_00223385 predicted 504
4 SASI_Hs01_00223387 predicted 3426
5 SASI_Hs01_00223388 predicted 1414
6 SASI_Hs01_00223389 predicted 569
7 SASI_Hs01_00223390 predicted 443
8 SASI_Hs01_00223391 predicted 4090
9 SASI_Hs01_00223392 predicted 1150
10 SASI_Hs01_00223386 predicted 3314
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139093 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00057891 predicted 1885
2 SASI_Rn01_00057892 predicted 2740
3 SASI_Rn01_00057893 predicted 1613
4 SASI_Rn02_00268459 predicted 3975
5 SASI_Rn01_00057895 predicted 3341
6 SASI_Rn01_00057897 predicted 2696
7 SASI_Rn01_00057899 predicted 4329
8 SASI_Rn01_00057900 predicted 3843
9 SASI_Rn02_00268460 predicted 2553
10 SASI_Rn02_00268461 predicted 3653
11 SASI_Rn01_00057894 predicted 742
12 SASI_Rn01_00057896 predicted 684
13 SASI_Rn01_00057898 predicted 4970
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081118 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00295361 predicted 983
2 SASI_Mm02_00295362 predicted 407
3 SASI_Mm02_00295363 predicted 2049
4 SASI_Mm02_00295364 predicted 1749
5 SASI_Mm02_00295365 predicted 2081
6 SASI_Mm02_00295366 predicted 455
7 SASI_Mm02_00295367 predicted 1229
8 SASI_Mm02_00295368 predicted 4083
9 SASI_Mm02_00295369 predicted 377
10 SASI_Mm02_00295370 predicted 570
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_133935 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00229236 predicted 982
2 SASI_Mm01_00229237 predicted 4113
3 SASI_Mm01_00229238 predicted 421
4 SASI_Mm01_00229239 predicted 2060
5 SASI_Mm01_00229240 predicted 2073
6 SASI_Mm01_00229241 predicted 1759
7 SASI_Mm01_00229242 predicted 2091
8 SASI_Mm01_00229243 predicted 453
9 SASI_Mm01_00229244 predicted 1231
10 SASI_Mm01_00229245 predicted 386
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020901
VALIDATED
PHRF1 MISSION shRNA Bacterial Glycerol Stock
PHD and ring finger domains 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000359824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_020901.2-3892s21c1
Sequence:CCGGACGACCTGGACCTGGATTATGCTCGAGCATAATCCAGGTCCAGGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_020901.2-2449s21c1
Sequence:CCGGTTGAGAGCTTCCGGATCAATACTCGAGTATTGATCCGGAAGCTCTCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_020901.2-568s21c1
Sequence:CCGGCAGTTGATCGAACTCTATTTACTCGAGTAAATAGAGTTCGATCAACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020901.1-3929s1c1
Sequence:CCGGCGGACACGTCTTTGATGATTTCTCGAGAAATCATCAAAGACGTGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074343    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_020901.1-5264s1c1
Sequence:CCGGCCTGTGTTGCTCACAGTTGAACTCGAGTTCAACTGTGAGCAACACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020901.1-600s1c1
Sequence:CCGGCGAGCTCAATTTGGTGGTAAACTCGAGTTTACCACCAAATTGAGCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020901.1-2162s1c1
Sequence:CCGGGCTACCCAGGATACCAAAGATCTCGAGATCTTTGGTATCCTGGGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_020901.1-3434s1c1
Sequence:CCGGGCACTATGAGAGTAGGAAGAACTCGAGTTCTTCCTACTCTCATAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020901
VALIDATED
PHRF1 MISSION shRNA shRNA Plasmid DNA
PHD and ring finger domains 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000359824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_020901.2-3892s21c1
Sequence:CCGGACGACCTGGACCTGGATTATGCTCGAGCATAATCCAGGTCCAGGTCGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000359825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_020901.2-2449s21c1
Sequence:CCGGTTGAGAGCTTCCGGATCAATACTCGAGTATTGATCCGGAAGCTCTCAATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000359826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_020901.2-568s21c1
Sequence:CCGGCAGTTGATCGAACTCTATTTACTCGAGTAAATAGAGTTCGATCAACTGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000074344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020901.1-3929s1c1
Sequence:CCGGCGGACACGTCTTTGATGATTTCTCGAGAAATCATCAAAGACGTGTCCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000074343    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_020901.1-5264s1c1
Sequence:CCGGCCTGTGTTGCTCACAGTTGAACTCGAGTTCAACTGTGAGCAACACAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000074345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020901.1-600s1c1
Sequence:CCGGCGAGCTCAATTTGGTGGTAAACTCGAGTTTACCACCAAATTGAGCTCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000074347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020901.1-2162s1c1
Sequence:CCGGGCTACCCAGGATACCAAAGATCTCGAGATCTTTGGTATCCTGGGTAGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000074346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_020901.1-3434s1c1
Sequence:CCGGGCACTATGAGAGTAGGAAGAACTCGAGTTCTTCCTACTCTCATAGTGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020901
VALIDATED
PHRF1 MISSION shRNA Lentiviral Transduction Particles
PHD and ring finger domains 1
Human
8 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000359824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_020901.2-3892s21c1
Sequence:CCGGACGACCTGGACCTGGATTATGCTCGAGCATAATCCAGGTCCAGGTCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_020901.2-2449s21c1
Sequence:CCGGTTGAGAGCTTCCGGATCAATACTCGAGTATTGATCCGGAAGCTCTCAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_020901.2-568s21c1
Sequence:CCGGCAGTTGATCGAACTCTATTTACTCGAGTAAATAGAGTTCGATCAACTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020901.1-3929s1c1
Sequence:CCGGCGGACACGTCTTTGATGATTTCTCGAGAAATCATCAAAGACGTGTCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074343    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_020901.1-5264s1c1
Sequence:CCGGCCTGTGTTGCTCACAGTTGAACTCGAGTTCAACTGTGAGCAACACAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020901.1-600s1c1
Sequence:CCGGCGAGCTCAATTTGGTGGTAAACTCGAGTTTACCACCAAATTGAGCTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020901.1-2162s1c1
Sequence:CCGGGCTACCCAGGATACCAAAGATCTCGAGATCTTTGGTATCCTGGGTAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_020901.1-3434s1c1
Sequence:CCGGGCACTATGAGAGTAGGAAGAACTCGAGTTCTTCCTACTCTCATAGTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081118
VALIDATED
PHRF1 MISSION shRNA Bacterial Glycerol Stock
PHD and ring finger domains 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081118.1-595s21c1
Sequence:CCGGTGTATTCGTGCCCAGTTTAATCTCGAGATTAAACTGGGCACGAATACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081118.1-1746s21c1
Sequence:CCGGTGTTTCTCTTCAGCGAAATTCCTCGAGGAATTTCGCTGAAGAGAAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081118.1-1239s21c1
Sequence:CCGGGAAACGTCAGCACCGTGTAAGCTCGAGCTTACACGGTGCTGACGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081118.1-411s21c1
Sequence:CCGGAGCTAGCAGTGTACCCAATTCCTCGAGGAATTGGGTACACTGCTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081118.1-498s21c1
Sequence:CCGGAGAGACCTGTGCCCATTATTTCTCGAGAAATAATGGGCACAGGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081118
VALIDATED
PHRF1 MISSION shRNA shRNA Plasmid DNA
PHD and ring finger domains 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081118.1-595s21c1
Sequence:CCGGTGTATTCGTGCCCAGTTTAATCTCGAGATTAAACTGGGCACGAATACATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000252250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081118.1-1746s21c1
Sequence:CCGGTGTTTCTCTTCAGCGAAATTCCTCGAGGAATTTCGCTGAAGAGAAACATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000252248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081118.1-1239s21c1
Sequence:CCGGGAAACGTCAGCACCGTGTAAGCTCGAGCTTACACGGTGCTGACGTTTCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000258188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081118.1-411s21c1
Sequence:CCGGAGCTAGCAGTGTACCCAATTCCTCGAGGAATTGGGTACACTGCTAGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000258211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081118.1-498s21c1
Sequence:CCGGAGAGACCTGTGCCCATTATTTCTCGAGAAATAATGGGCACAGGTCTCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081118
VALIDATED
PHRF1 MISSION shRNA Lentiviral Transduction Particles
PHD and ring finger domains 1
Mouse
5 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000252249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081118.1-595s21c1
Sequence:CCGGTGTATTCGTGCCCAGTTTAATCTCGAGATTAAACTGGGCACGAATACATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081118.1-1746s21c1
Sequence:CCGGTGTTTCTCTTCAGCGAAATTCCTCGAGGAATTTCGCTGAAGAGAAACATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081118.1-1239s21c1
Sequence:CCGGGAAACGTCAGCACCGTGTAAGCTCGAGCTTACACGGTGCTGACGTTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000258188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081118.1-411s21c1
Sequence:CCGGAGCTAGCAGTGTACCCAATTCCTCGAGGAATTGGGTACACTGCTAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000258211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081118.1-498s21c1
Sequence:CCGGAGAGACCTGTGCCCATTATTTCTCGAGAAATAATGGGCACAGGTCTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)