EMAIL THIS PAGE TO A FRIEND

PHTF1

putative homeodomain transcription factor 1

117 Gene Product Result for
Synonyms: PHTF
UniProtKB ID: Q9UMS5, Q5VWP7, Q5VWP8, Q9BUP2, Q9H1X8
Gene ID:
Mouse(18685) putative homeodomain transcription factor 1
Rat(252962) putative homeodomain transcription factor 1
chicken(419878) putative homeodomain transcription factor 1
Horse(100059170) putative homeodomain transcription factor 1
domestic cat(101099572) putative homeodomain transcription factor 1
dog(483123) putative homeodomain transcription factor 1
cow(536504) putative homeodomain transcription factor 1
sheep(101119349) putative homeodomain transcription factor 1
Domestic Rabbit(100354795) putative homeodomain transcription factor 1
naked mole-rat(101709757) putative homeodomain transcription factor 1
domestic guinea pig(100716686) putative homeodomain transcription factor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013629 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013629 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013629 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006608 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006608 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006608 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006608 Rosetta Predictions human pricing
XM_001065811 Rosetta Predictions rat pricing
XM_001065861 Rosetta Predictions rat pricing
XM_001073852 Rosetta Predictions rat pricing
XM_342306 Rosetta Predictions rat pricing
NM_013629 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006608 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00341935 predicted 994
2 SASI_Hs01_00164029 predicted 2612
3 SASI_Hs01_00164030 predicted 1423
4 SASI_Hs01_00164031 predicted 2548
5 SASI_Hs01_00164032 predicted 1441
6 SASI_Hs02_00341936 predicted 581
7 SASI_Hs02_00341937 predicted 585
8 SASI_Hs01_00164034 predicted 2820
9 SASI_Hs02_00341938 predicted 2782
10 SASI_Hs01_00164035 predicted 1549
11 SASI_Hs01_00164026 predicted 639
12 SASI_Hs01_00164027 predicted 1896
13 SASI_Hs01_00164028 predicted 297
14 SASI_Hs01_00164033 predicted 934
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065811 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00315431 predicted 1007
2 SASI_Rn02_00315432 predicted 1141
3 SASI_Rn02_00315433 predicted 2018
4 SASI_Rn02_00315434 predicted 1496
5 SASI_Rn02_00315435 predicted 2300
6 SASI_Rn02_00315436 predicted 955
7 SASI_Rn02_00315437 predicted 1133
8 SASI_Rn02_00315438 predicted 784
9 SASI_Rn02_00315439 predicted 1256
10 SASI_Rn02_00315440 predicted 2246
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065861 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00315534 predicted 1390
2 SASI_Rn02_00315535 predicted 1530
3 SASI_Rn02_00315536 predicted 2407
4 SASI_Rn02_00315537 predicted 1889
5 SASI_Rn02_00315538 predicted 2691
6 SASI_Rn02_00315539 predicted 1336
7 SASI_Rn02_00315540 predicted 1517
8 SASI_Rn02_00315541 predicted 1172
9 SASI_Rn02_00315542 predicted 1635
10 SASI_Rn02_00315543 predicted 2637
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073852 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00344177 predicted 1002
2 SASI_Rn02_00344178 predicted 1146
3 SASI_Rn02_00344179 predicted 2022
4 SASI_Rn02_00344180 predicted 1504
5 SASI_Rn02_00344181 predicted 2307
6 SASI_Rn02_00344182 predicted 952
7 SASI_Rn02_00344183 predicted 1126
8 SASI_Rn02_00344184 predicted 782
9 SASI_Rn02_00344185 predicted 1255
10 SASI_Rn02_00344186 predicted 2248
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342306 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00394077 predicted 1385
2 SASI_Rn02_00394078 predicted 1533
3 SASI_Rn02_00394079 predicted 2406
4 SASI_Rn02_00394080 predicted 1890
5 SASI_Rn02_00394081 predicted 2690
6 SASI_Rn02_00394082 predicted 1338
7 SASI_Rn02_00394083 predicted 1515
8 SASI_Rn02_00394084 predicted 1174
9 SASI_Rn02_00394085 predicted 1636
10 SASI_Rn02_00394086 predicted 2632
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013629 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00188599 predicted 1605
2 SASI_Mm01_00188601 predicted 1301
3 SASI_Mm02_00322408 predicted 1657
4 SASI_Mm02_00322409 predicted 1572
5 SASI_Mm01_00188602 predicted 2432
6 SASI_Mm01_00188603 predicted 2636
7 SASI_Mm01_00188604 predicted 1586
8 SASI_Mm01_00188605 predicted 1191
9 SASI_Mm01_00188606 predicted 2713
10 SASI_Mm01_00188607 predicted 960
11 SASI_Mm01_00188600 predicted 1468
12 SASI_Mm01_00188608 predicted 1362
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013629
VALIDATED
PHTF1 MISSION shRNA Bacterial Glycerol Stock
putative homeodomain transcription factor 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000075416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013629.1-1450s1c1
Sequence:CCGGGCGTCAAGTGACAATGGTTATCTCGAGATAACCATTGTCACTTGACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075413    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013629.1-3047s1c1
Sequence:CCGGGCAGCGTGAATAGTCAGCAAACTCGAGTTTGCTGACTATTCACGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013629.1-2679s1c1
Sequence:CCGGGCTGTCCACAAAGCTGTTAAACTCGAGTTTAACAGCTTTGTGGACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013629.1-1503s1c1
Sequence:CCGGGCACCTAAATTCTCAGGTAAACTCGAGTTTACCTGAGAATTTAGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013629.1-1866s21c1
Sequence:CCGGTGAGCGAGTTAGTGCGATAATCTCGAGATTATCGCACTAACTCGCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013629.1-1241s1c1
Sequence:CCGGGCTGTTTCCATCCTATCCTTACTCGAGTAAGGATAGGATGGAAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013629.1-1450s21c1
Sequence:CCGGGCGTCAAGTGACAATGGTTATCTCGAGATAACCATTGTCACTTGACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301860    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013629.1-3047s21c1
Sequence:CCGGGCAGCGTGAATAGTCAGCAAACTCGAGTTTGCTGACTATTCACGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013629.1-724s21c1
Sequence:CCGGTTAATCAGAGGCTCAACATTTCTCGAGAAATGTTGAGCCTCTGATTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013629.1-1171s21c1
Sequence:CCGGCTCTTTGGCAACAGGATTAAACTCGAGTTTAATCCTGTTGCCAAAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013629
VALIDATED
PHTF1 MISSION shRNA shRNA Plasmid DNA
putative homeodomain transcription factor 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000075416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013629.1-1450s1c1
Sequence:CCGGGCGTCAAGTGACAATGGTTATCTCGAGATAACCATTGTCACTTGACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075413    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013629.1-3047s1c1
Sequence:CCGGGCAGCGTGAATAGTCAGCAAACTCGAGTTTGCTGACTATTCACGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013629.1-2679s1c1
Sequence:CCGGGCTGTCCACAAAGCTGTTAAACTCGAGTTTAACAGCTTTGTGGACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013629.1-1503s1c1
Sequence:CCGGGCACCTAAATTCTCAGGTAAACTCGAGTTTACCTGAGAATTTAGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013629.1-1866s21c1
Sequence:CCGGTGAGCGAGTTAGTGCGATAATCTCGAGATTATCGCACTAACTCGCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013629.1-1241s1c1
Sequence:CCGGGCTGTTTCCATCCTATCCTTACTCGAGTAAGGATAGGATGGAAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013629.1-1450s21c1
Sequence:CCGGGCGTCAAGTGACAATGGTTATCTCGAGATAACCATTGTCACTTGACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301860    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013629.1-3047s21c1
Sequence:CCGGGCAGCGTGAATAGTCAGCAAACTCGAGTTTGCTGACTATTCACGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013629.1-724s21c1
Sequence:CCGGTTAATCAGAGGCTCAACATTTCTCGAGAAATGTTGAGCCTCTGATTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013629.1-1171s21c1
Sequence:CCGGCTCTTTGGCAACAGGATTAAACTCGAGTTTAATCCTGTTGCCAAAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013629
VALIDATED
PHTF1 MISSION shRNA Lentiviral Transduction Particles
putative homeodomain transcription factor 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000075416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013629.1-1450s1c1
Sequence:CCGGGCGTCAAGTGACAATGGTTATCTCGAGATAACCATTGTCACTTGACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075413    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013629.1-3047s1c1
Sequence:CCGGGCAGCGTGAATAGTCAGCAAACTCGAGTTTGCTGACTATTCACGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013629.1-2679s1c1
Sequence:CCGGGCTGTCCACAAAGCTGTTAAACTCGAGTTTAACAGCTTTGTGGACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013629.1-1503s1c1
Sequence:CCGGGCACCTAAATTCTCAGGTAAACTCGAGTTTACCTGAGAATTTAGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013629.1-1866s21c1
Sequence:CCGGTGAGCGAGTTAGTGCGATAATCTCGAGATTATCGCACTAACTCGCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013629.1-1241s1c1
Sequence:CCGGGCTGTTTCCATCCTATCCTTACTCGAGTAAGGATAGGATGGAAACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013629.1-1450s21c1
Sequence:CCGGGCGTCAAGTGACAATGGTTATCTCGAGATAACCATTGTCACTTGACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301860    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013629.1-3047s21c1
Sequence:CCGGGCAGCGTGAATAGTCAGCAAACTCGAGTTTGCTGACTATTCACGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013629.1-724s21c1
Sequence:CCGGTTAATCAGAGGCTCAACATTTCTCGAGAAATGTTGAGCCTCTGATTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013629.1-1171s21c1
Sequence:CCGGCTCTTTGGCAACAGGATTAAACTCGAGTTTAATCCTGTTGCCAAAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006608
PHTF1 MISSION shRNA Bacterial Glycerol Stock
putative homeodomain transcription factor 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000014693    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006608.1-2650s1c1
Sequence:CCGGGCAACTATGATAGATGCCCAACTCGAGTTGGGCATCTATCATAGTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006608.1-573s1c1
Sequence:CCGGCCTCTGATAAAGTCAGAGGAACTCGAGTTCCTCTGACTTTATCAGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006608.1-722s1c1
Sequence:CCGGCCTATCATTAAGAGGAGACAACTCGAGTTGTCTCCTCTTAATGATAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006608.1-973s1c1
Sequence:CCGGGCACCTAAACTCTCAGGTAAACTCGAGTTTACCTGAGAGTTTAGGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006608.1-1604s1c1
Sequence:CCGGCCTATTATTGTTTGGTCGATACTCGAGTATCGACCAAACAATAATAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006608.2-615s21c1
Sequence:CCGGTTAATCAGAGGGTCAACATTTCTCGAGAAATGTTGACCCTCTGATTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006608.2-2234s21c1
Sequence:CCGGATCACTGCGTTCCTATCTAAACTCGAGTTTAGATAGGAACGCAGTGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006608.2-2648s21c1
Sequence:CCGGCAATATCACAAGAGTAGTTATCTCGAGATAACTACTCTTGTGATATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006608
PHTF1 MISSION shRNA shRNA Plasmid DNA
putative homeodomain transcription factor 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000014693    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006608.1-2650s1c1
Sequence:CCGGGCAACTATGATAGATGCCCAACTCGAGTTGGGCATCTATCATAGTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006608.1-573s1c1
Sequence:CCGGCCTCTGATAAAGTCAGAGGAACTCGAGTTCCTCTGACTTTATCAGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006608.1-722s1c1
Sequence:CCGGCCTATCATTAAGAGGAGACAACTCGAGTTGTCTCCTCTTAATGATAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006608.1-973s1c1
Sequence:CCGGGCACCTAAACTCTCAGGTAAACTCGAGTTTACCTGAGAGTTTAGGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006608.1-1604s1c1
Sequence:CCGGCCTATTATTGTTTGGTCGATACTCGAGTATCGACCAAACAATAATAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006608.2-615s21c1
Sequence:CCGGTTAATCAGAGGGTCAACATTTCTCGAGAAATGTTGACCCTCTGATTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006608.2-2234s21c1
Sequence:CCGGATCACTGCGTTCCTATCTAAACTCGAGTTTAGATAGGAACGCAGTGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006608.2-2648s21c1
Sequence:CCGGCAATATCACAAGAGTAGTTATCTCGAGATAACTACTCTTGTGATATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006608
PHTF1 MISSION shRNA Lentiviral Transduction Particles
putative homeodomain transcription factor 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000014693    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006608.1-2650s1c1
Sequence:CCGGGCAACTATGATAGATGCCCAACTCGAGTTGGGCATCTATCATAGTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006608.1-573s1c1
Sequence:CCGGCCTCTGATAAAGTCAGAGGAACTCGAGTTCCTCTGACTTTATCAGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006608.1-722s1c1
Sequence:CCGGCCTATCATTAAGAGGAGACAACTCGAGTTGTCTCCTCTTAATGATAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006608.1-973s1c1
Sequence:CCGGGCACCTAAACTCTCAGGTAAACTCGAGTTTACCTGAGAGTTTAGGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006608.1-1604s1c1
Sequence:CCGGCCTATTATTGTTTGGTCGATACTCGAGTATCGACCAAACAATAATAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006608.2-615s21c1
Sequence:CCGGTTAATCAGAGGGTCAACATTTCTCGAGAAATGTTGACCCTCTGATTAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006608.2-2234s21c1
Sequence:CCGGATCACTGCGTTCCTATCTAAACTCGAGTTTAGATAGGAACGCAGTGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006608.2-2648s21c1
Sequence:CCGGCAATATCACAAGAGTAGTTATCTCGAGATAACTACTCTTGTGATATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)