EMAIL THIS PAGE TO A FRIEND

PHTF2

putative homeodomain transcription factor 2

245 Gene Product Result for
Gene ID:
Mouse(68770) putative homeodomain transcription factor 2
Rat(296762) putative homeodomain transcription factor 2
domestic guinea pig(100726115) putative homeodomain transcription factor 2
naked mole-rat(101699054) putative homeodomain transcription factor 2
Domestic Rabbit(100338895) putative homeodomain transcription factor 2
cow(520774) putative homeodomain transcription factor 2
sheep(101116646) putative homeodomain transcription factor 2
chicken(417728) putative homeodomain transcription factor 2
domestic cat(101089427) putative homeodomain transcription factor 2
Horse(100057134) putative homeodomain transcription factor 2
dog(483280) putative homeodomain transcription factor 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020432 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020432 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020432 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172992 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172992 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172992 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001127357 Rosetta Predictions human pricing
NM_001127358 Rosetta Predictions human pricing
NM_001127359 Rosetta Predictions human pricing
NM_001127360 Rosetta Predictions human pricing
NM_020432 Rosetta Predictions human pricing
NM_001106577 Rosetta Predictions rat pricing
NM_172992 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127357 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00329174 predicted 479
2 SASI_Hs02_00329175 predicted 840
3 SASI_Hs02_00329176 predicted 729
4 SASI_Hs02_00329177 predicted 459
5 SASI_Hs02_00329178 predicted 826
6 SASI_Hs02_00329179 predicted 469
7 SASI_Hs02_00329180 predicted 565
8 SASI_Hs02_00329181 predicted 535
9 SASI_Hs02_00329182 predicted 511
10 SASI_Hs02_00329183 predicted 521
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127358 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00329184 predicted 554
2 SASI_Hs02_00329185 predicted 917
3 SASI_Hs02_00329186 predicted 798
4 SASI_Hs02_00329187 predicted 542
5 SASI_Hs02_00329188 predicted 910
6 SASI_Hs02_00329189 predicted 545
7 SASI_Hs02_00329190 predicted 635
8 SASI_Hs02_00329191 predicted 610
9 SASI_Hs02_00329192 predicted 579
10 SASI_Hs02_00329193 predicted 593
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127359 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00329194 predicted 474
2 SASI_Hs02_00329195 predicted 841
3 SASI_Hs02_00329196 predicted 727
4 SASI_Hs02_00329197 predicted 456
5 SASI_Hs02_00329198 predicted 828
6 SASI_Hs02_00329199 predicted 469
7 SASI_Hs02_00329200 predicted 562
8 SASI_Hs02_00329201 predicted 532
9 SASI_Hs02_00329202 predicted 503
10 SASI_Hs02_00329203 predicted 514
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127360 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00329204 predicted 556
2 SASI_Hs02_00329205 predicted 916
3 SASI_Hs02_00329206 predicted 798
4 SASI_Hs02_00329207 predicted 534
5 SASI_Hs02_00329208 predicted 905
6 SASI_Hs02_00329209 predicted 548
7 SASI_Hs02_00329210 predicted 637
8 SASI_Hs02_00329211 predicted 607
9 SASI_Hs02_00329212 predicted 583
10 SASI_Hs02_00329213 predicted 598
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020432 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00101655 predicted 461
2 SASI_Hs02_00353447 predicted 824
3 SASI_Hs01_00101661 predicted 709
4 SASI_Hs01_00101662 predicted 450
5 SASI_Hs02_00353448 predicted 818
6 SASI_Hs01_00101664 predicted 453
7 SASI_Hs02_00353449 predicted 552
8 SASI_Hs02_00353450 predicted 525
9 SASI_Hs02_00353451 predicted 497
10 SASI_Hs02_00353452 predicted 504
11 SASI_Hs01_00101656 predicted 1276
12 SASI_Hs01_00101657 predicted 456
13 SASI_Hs01_00101658 predicted 2241
14 SASI_Hs01_00101659 predicted 758
15 SASI_Hs01_00101660 predicted 2160
16 SASI_Hs01_00101663 predicted 2309
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106577 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00220328 predicted 1683
2 SASI_Rn02_00220329 predicted 2119
3 SASI_Rn02_00220330 predicted 620
4 SASI_Rn02_00220331 predicted 2144
5 SASI_Rn02_00220332 predicted 1752
6 SASI_Rn02_00220333 predicted 1955
7 SASI_Rn02_00220334 predicted 2082
8 SASI_Rn02_00220335 predicted 619
9 SASI_Rn02_00220336 predicted 937
10 SASI_Rn02_00220337 predicted 839
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172992 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00061885 predicted 1512
2 SASI_Mm01_00061886 predicted 2137
3 SASI_Mm01_00061887 predicted 429
4 SASI_Mm01_00061888 predicted 366
5 SASI_Mm01_00061889 predicted 2202
6 SASI_Mm01_00061891 predicted 523
7 SASI_Mm01_00061892 predicted 397
8 SASI_Mm01_00061893 predicted 1557
9 SASI_Mm01_00061894 predicted 2164
10 SASI_Mm02_00345041 predicted 2167
11 SASI_Mm01_00061890 predicted 217
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020432
VALIDATED
PHTF2 MISSION shRNA Bacterial Glycerol Stock
putative homeodomain transcription factor 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000017178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_020432.2-627s1c1
Sequence:CCGGGCCAGATTGTTTCCACAAGAACTCGAGTTCTTGTGGAAACAATCTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_020432.2-1551s1c1
Sequence:CCGGGCCATATACCAGGAATAGGATCTCGAGATCCTATTCCTGGTATATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020432.2-1891s1c1
Sequence:CCGGCCGGTTGAAGAAAGTACAGAACTCGAGTTCTGTACTTTCTTCAACCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_020432.2-295s1c1
Sequence:CCGGGCTAAGGAATAAACCAAAGAACTCGAGTTCTTTGGTTTATTCCTTAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020432.2-1964s1c1
Sequence:CCGGCGATCAGTTGATGTAATAGTTCTCGAGAACTATTACATCAACTGATCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020432.4-231s21c1
Sequence:CCGGGCTAAGGAATAAACCAAAGAACTCGAGTTCTTTGGTTTATTCCTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274460    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020432.4-2626s21c1
Sequence:CCGGTACTTGAGATCCTGGTAATTGCTCGAGCAATTACCAGGATCTCAAGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_020432.4-1487s21c1
Sequence:CCGGGCCATATACCAGGAATAGGATCTCGAGATCCTATTCCTGGTATATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_020432.4-563s21c1
Sequence:CCGGGCCAGATTGTTTCCACAAGAACTCGAGTTCTTGTGGAAACAATCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020432.4-1091s21c1
Sequence:CCGGATAGAAAGTCACACCATTATACTCGAGTATAATGGTGTGACTTTCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020432
VALIDATED
PHTF2 MISSION shRNA shRNA Plasmid DNA
putative homeodomain transcription factor 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000017178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_020432.2-627s1c1
Sequence:CCGGGCCAGATTGTTTCCACAAGAACTCGAGTTCTTGTGGAAACAATCTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_020432.2-1551s1c1
Sequence:CCGGGCCATATACCAGGAATAGGATCTCGAGATCCTATTCCTGGTATATGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020432.2-1891s1c1
Sequence:CCGGCCGGTTGAAGAAAGTACAGAACTCGAGTTCTGTACTTTCTTCAACCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_020432.2-295s1c1
Sequence:CCGGGCTAAGGAATAAACCAAAGAACTCGAGTTCTTTGGTTTATTCCTTAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020432.2-1964s1c1
Sequence:CCGGCGATCAGTTGATGTAATAGTTCTCGAGAACTATTACATCAACTGATCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020432.4-231s21c1
Sequence:CCGGGCTAAGGAATAAACCAAAGAACTCGAGTTCTTTGGTTTATTCCTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274460    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020432.4-2626s21c1
Sequence:CCGGTACTTGAGATCCTGGTAATTGCTCGAGCAATTACCAGGATCTCAAGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_020432.4-1487s21c1
Sequence:CCGGGCCATATACCAGGAATAGGATCTCGAGATCCTATTCCTGGTATATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_020432.4-563s21c1
Sequence:CCGGGCCAGATTGTTTCCACAAGAACTCGAGTTCTTGTGGAAACAATCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020432.4-1091s21c1
Sequence:CCGGATAGAAAGTCACACCATTATACTCGAGTATAATGGTGTGACTTTCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020432
VALIDATED
PHTF2 MISSION shRNA Lentiviral Transduction Particles
putative homeodomain transcription factor 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000017178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_020432.2-627s1c1
Sequence:CCGGGCCAGATTGTTTCCACAAGAACTCGAGTTCTTGTGGAAACAATCTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_020432.2-1551s1c1
Sequence:CCGGGCCATATACCAGGAATAGGATCTCGAGATCCTATTCCTGGTATATGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020432.2-1891s1c1
Sequence:CCGGCCGGTTGAAGAAAGTACAGAACTCGAGTTCTGTACTTTCTTCAACCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_020432.2-295s1c1
Sequence:CCGGGCTAAGGAATAAACCAAAGAACTCGAGTTCTTTGGTTTATTCCTTAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020432.2-1964s1c1
Sequence:CCGGCGATCAGTTGATGTAATAGTTCTCGAGAACTATTACATCAACTGATCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020432.4-231s21c1
Sequence:CCGGGCTAAGGAATAAACCAAAGAACTCGAGTTCTTTGGTTTATTCCTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274460    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020432.4-2626s21c1
Sequence:CCGGTACTTGAGATCCTGGTAATTGCTCGAGCAATTACCAGGATCTCAAGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_020432.4-1487s21c1
Sequence:CCGGGCCATATACCAGGAATAGGATCTCGAGATCCTATTCCTGGTATATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_020432.4-563s21c1
Sequence:CCGGGCCAGATTGTTTCCACAAGAACTCGAGTTCTTGTGGAAACAATCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020432.4-1091s21c1
Sequence:CCGGATAGAAAGTCACACCATTATACTCGAGTATAATGGTGTGACTTTCTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172992
VALIDATED
PHTF2 MISSION shRNA Bacterial Glycerol Stock
putative homeodomain transcription factor 2
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000085753    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172992.2-3952s1c1
Sequence:CCGGGCGCTCTAATATGTCCAATAACTCGAGTTATTGGACATATTAGAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172992.2-1600s1c1
Sequence:CCGGGCGTCAGAACTTTATGTGATTCTCGAGAATCACATAAAGTTCTGACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172992.2-554s1c1
Sequence:CCGGGCCAGATTGTTTCAACAAGAACTCGAGTTCTTGTTGAAACAATCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172992.2-2227s1c1
Sequence:CCGGCCCTTTAGGTTGTATGGACTTCTCGAGAAGTCCATACAACCTAAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172992.2-660s1c1
Sequence:CCGGCGGTTCTAGCACCACAGATAACTCGAGTTATCTGTGGTGCTAGAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374256    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_172992.3-2838s21c1
Sequence:CCGGTACTTGAGGAATACGTCTTTACTCGAGTAAAGACGTATTCCTCAAGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172992.3-591s21c1
Sequence:CCGGTGAAGTGATTGGGCCAATATGCTCGAGCATATTGGCCCAATCACTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172992.3-1576s21c1
Sequence:CCGGGGCATAGGATACCAGGTATTTCTCGAGAAATACCTGGTATCCTATGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_172992.3-1169s21c1
Sequence:CCGGATAGAAAGCCACACCATTATACTCGAGTATAATGGTGTGGCTTTCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366040    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_172992.3-2748s21c1
Sequence:CCGGCTGGTAATTGTTGACGTAATTCTCGAGAATTACGTCAACAATTACCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_172992.3-2178s21c1
Sequence:CCGGCAATACCTCAATCCTACTTACCTCGAGGTAAGTAGGATTGAGGTATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172992
VALIDATED
PHTF2 MISSION shRNA shRNA Plasmid DNA
putative homeodomain transcription factor 2
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000085753    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172992.2-3952s1c1
Sequence:CCGGGCGCTCTAATATGTCCAATAACTCGAGTTATTGGACATATTAGAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172992.2-1600s1c1
Sequence:CCGGGCGTCAGAACTTTATGTGATTCTCGAGAATCACATAAAGTTCTGACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172992.2-554s1c1
Sequence:CCGGGCCAGATTGTTTCAACAAGAACTCGAGTTCTTGTTGAAACAATCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172992.2-2227s1c1
Sequence:CCGGCCCTTTAGGTTGTATGGACTTCTCGAGAAGTCCATACAACCTAAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172992.2-660s1c1
Sequence:CCGGCGGTTCTAGCACCACAGATAACTCGAGTTATCTGTGGTGCTAGAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374256    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_172992.3-2838s21c1
Sequence:CCGGTACTTGAGGAATACGTCTTTACTCGAGTAAAGACGTATTCCTCAAGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172992.3-591s21c1
Sequence:CCGGTGAAGTGATTGGGCCAATATGCTCGAGCATATTGGCCCAATCACTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172992.3-1576s21c1
Sequence:CCGGGGCATAGGATACCAGGTATTTCTCGAGAAATACCTGGTATCCTATGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_172992.3-1169s21c1
Sequence:CCGGATAGAAAGCCACACCATTATACTCGAGTATAATGGTGTGGCTTTCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366040    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_172992.3-2748s21c1
Sequence:CCGGCTGGTAATTGTTGACGTAATTCTCGAGAATTACGTCAACAATTACCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_172992.3-2178s21c1
Sequence:CCGGCAATACCTCAATCCTACTTACCTCGAGGTAAGTAGGATTGAGGTATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172992
VALIDATED
PHTF2 MISSION shRNA Lentiviral Transduction Particles
putative homeodomain transcription factor 2
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000085753    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172992.2-3952s1c1
Sequence:CCGGGCGCTCTAATATGTCCAATAACTCGAGTTATTGGACATATTAGAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172992.2-1600s1c1
Sequence:CCGGGCGTCAGAACTTTATGTGATTCTCGAGAATCACATAAAGTTCTGACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172992.2-554s1c1
Sequence:CCGGGCCAGATTGTTTCAACAAGAACTCGAGTTCTTGTTGAAACAATCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172992.2-2227s1c1
Sequence:CCGGCCCTTTAGGTTGTATGGACTTCTCGAGAAGTCCATACAACCTAAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172992.2-660s1c1
Sequence:CCGGCGGTTCTAGCACCACAGATAACTCGAGTTATCTGTGGTGCTAGAACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374256    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_172992.3-2838s21c1
Sequence:CCGGTACTTGAGGAATACGTCTTTACTCGAGTAAAGACGTATTCCTCAAGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172992.3-591s21c1
Sequence:CCGGTGAAGTGATTGGGCCAATATGCTCGAGCATATTGGCCCAATCACTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172992.3-1576s21c1
Sequence:CCGGGGCATAGGATACCAGGTATTTCTCGAGAAATACCTGGTATCCTATGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_172992.3-1169s21c1
Sequence:CCGGATAGAAAGCCACACCATTATACTCGAGTATAATGGTGTGGCTTTCTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366040    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_172992.3-2748s21c1
Sequence:CCGGCTGGTAATTGTTGACGTAATTCTCGAGAATTACGTCAACAATTACCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_172992.3-2178s21c1
Sequence:CCGGCAATACCTCAATCCTACTTACCTCGAGGTAAGTAGGATTGAGGTATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)