EMAIL THIS PAGE TO A FRIEND

PHYH

phytanoyl-CoA 2-hydroxylase

70 Gene Product Result for
Synonyms: LN1 LNAP1 PAHX PHYH1 RD
UniProtKB ID: O14832, A8MTS8, B1ALH5
Gene ID:
Human(5264) Summary: This gene is a member of the PhyH family and encodes a peroxisomal protein that is involved in the alpha-oxidation of 3-methyl branched fatty acids. Specifically, this protein converts phytanoyl-CoA to 2-hydroxyphytanoyl-CoA. Mutations in this gene have been associated with Refsum disease (RD) and deficient protein activity has been associated with Zellweger syndrome and rhizomelic chondrodysplasia punctata. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Mouse(16922) phytanoyl-CoA hydroxylase
Rat(114209) phytanoyl-CoA 2-hydroxylase
Zebrafish(550521) phytanoyl-CoA 2-hydroxylase
chicken(426601) phytanoyl-CoA 2-hydroxylase
domestic cat(101098238) phytanoyl-CoA 2-hydroxylase
cow(281400) phytanoyl-CoA 2-hydroxylase
naked mole-rat(101717354) phytanoyl-CoA 2-hydroxylase
domestic guinea pig(100721980) phytanoyl-CoA 2-hydroxylase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1406256 Anti-PHYH antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA007598 Anti-PHYH antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation mouse, human
immunohistochemistry, western blot pricing
HPA011796 Anti-PHYH antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunohistochemistry, western blot pricing
WH0005264M1 Monoclonal Anti-PHYH antibody produced in mouse clone 1F2-5B9, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB5201635 Monoclonal Anti-Phyh/Pahx - Alkaline Phosphatase antibody produced in mouse clone S210-5, purified immunoglobulin mouse, human, rat
immunocytochemistry, western blot pricing
SAB5201636 Monoclonal Anti-Phyh/Pahx - Apc antibody produced in mouse clone S210-5, purified immunoglobulin rat, mouse, human
immunocytochemistry, western blot pricing
SAB5201627 Monoclonal Anti-Phyh/Pahx - Atto 390 antibody produced in mouse clone S210-5, purified immunoglobulin human, mouse, rat
immunocytochemistry, western blot pricing
SAB5201628 Monoclonal Anti-Phyh/Pahx - Atto 488 antibody produced in mouse clone S210-5, purified immunoglobulin human, rat, mouse
immunocytochemistry, western blot pricing
SAB5201629 Monoclonal Anti-Phyh/Pahx - Atto 565 antibody produced in mouse clone S210-5, purified immunoglobulin mouse, human, rat
immunocytochemistry, western blot pricing
SAB5201630 Monoclonal Anti-Phyh/Pahx - Atto 594 antibody produced in mouse clone S210-5, purified immunoglobulin mouse, human, rat
immunocytochemistry, western blot pricing
SAB5201631 Monoclonal Anti-Phyh/Pahx - Atto 633 antibody produced in mouse clone S210-5, purified immunoglobulin rat, human, mouse
immunocytochemistry, western blot pricing
SAB5201632 Monoclonal Anti-Phyh/Pahx - Atto 655 antibody produced in mouse clone S210-5, purified immunoglobulin mouse, rat, human
immunocytochemistry, western blot pricing
SAB5201633 Monoclonal Anti-Phyh/Pahx - Atto 680 antibody produced in mouse clone S210-5, purified immunoglobulin human, mouse, rat
immunocytochemistry, western blot pricing
SAB5201634 Monoclonal Anti-Phyh/Pahx - Atto 700 antibody produced in mouse clone S210-5, purified immunoglobulin mouse, rat, human
immunocytochemistry, western blot pricing
SAB5201637 Monoclonal Anti-Phyh/Pahx - Biotin antibody produced in mouse clone S210-5, purified immunoglobulin rat, human, mouse
immunocytochemistry, western blot pricing
SAB5201638 Monoclonal Anti-Phyh/Pahx - Fitc antibody produced in mouse clone S210-5, purified immunoglobulin mouse, rat, human
immunocytochemistry, western blot pricing
SAB5201639 Monoclonal Anti-Phyh/Pahx - Hrp antibody produced in mouse clone S210-5, purified immunoglobulin human, mouse, rat
immunocytochemistry, western blot pricing
SAB5201640 Monoclonal Anti-Phyh/Pahx - Pe/Atto 594 antibody produced in mouse clone S210-5, purified immunoglobulin human, rat, mouse
immunocytochemistry, western blot pricing
SAB5201641 Monoclonal Anti-Phyh/Pahx - Percp antibody produced in mouse clone S210-5, purified immunoglobulin human, mouse, rat
immunocytochemistry, western blot pricing
SAB5201642 Monoclonal Anti-Phyh/Pahx - Rpe antibody produced in mouse clone S210-5, purified immunoglobulin rat, mouse, human
immunocytochemistry, western blot pricing
SAB5201643 Monoclonal Anti-Phyh/Pahx - Streptavidin antibody produced in mouse clone S210-5, purified immunoglobulin mouse, human, rat
immunocytochemistry, western blot pricing
SAB5201626 Monoclonal Anti-Phyh/Pahx antibody produced in mouse clone S210-5, purified immunoglobulin human, rat, mouse
immunocytochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010726 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010726 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010726 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006214 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006214 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006214 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001037537 Rosetta Predictions human pricing
NM_006214 Rosetta Predictions human pricing
NM_053674 Rosetta Predictions rat pricing
NM_010726 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037537 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00012824 predicted 1003
2 SASI_Hs01_00012826 predicted 641
3 SASI_Hs01_00012827 predicted 1103
4 SASI_Hs01_00012828 predicted 1031
5 SASI_Hs01_00012829 predicted 629
6 SASI_Hs01_00012830 predicted 643
7 SASI_Hs01_00012831 predicted 652
8 SASI_Hs01_00012832 predicted 894
9 SASI_Hs01_00012833 predicted 1045
10 SASI_Hs02_00308318 predicted 1042
11 SASI_Hs01_00012825 predicted 553
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006214 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00054222 predicted 902
2 SASI_Hs01_00054224 predicted 540
3 SASI_Hs01_00054225 predicted 992
4 SASI_Hs01_00054226 predicted 923
5 SASI_Hs01_00054227 predicted 529
6 SASI_Hs01_00054228 predicted 545
7 SASI_Hs01_00054229 predicted 550
8 SASI_Hs01_00054230 predicted 785
9 SASI_Hs01_00054231 predicted 947
10 SASI_Hs02_00341123 predicted 934
11 SASI_Hs01_00054223 predicted 448
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053674 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00078253 predicted 464
2 SASI_Rn01_00078254 predicted 448
3 SASI_Rn01_00078255 predicted 610
4 SASI_Rn01_00078256 predicted 322
5 SASI_Rn01_00078257 predicted 925
6 SASI_Rn01_00078258 predicted 903
7 SASI_Rn01_00078259 predicted 524
8 SASI_Rn01_00078260 predicted 810
9 SASI_Rn01_00078261 predicted 562
10 SASI_Rn01_00078262 predicted 463
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010726 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00319213 predicted 378
2 SASI_Mm02_00319214 predicted 1024
3 SASI_Mm02_00319215 predicted 1029
4 SASI_Mm02_00319216 predicted 976
5 SASI_Mm02_00319217 predicted 392
6 SASI_Mm02_00319218 predicted 203
7 SASI_Mm02_00319219 predicted 711
8 SASI_Mm02_00319220 predicted 1014
9 SASI_Mm02_00319221 predicted 262
10 SASI_Mm02_00319222 predicted 396
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010726
VALIDATED
PHYH MISSION shRNA Bacterial Glycerol Stock
phytanoyl-CoA 2-hydroxylase
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000314260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010726.2-195s21c1
Sequence:CCGGCCTGAACAATTCCAGTATACTCTCGAGAGTATACTGGAATTGTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010726.2-631s21c1
Sequence:CCGGGCAACCTAATTGTTTGTGCTTCTCGAGAAGCACAAACAATTAGGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183203    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010726.1-1213s1c1
Sequence:CCGGGAGGACATCAAAGCAAAGAAACTCGAGTTTCTTTGCTTTGATGTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183360    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010726.1-1189s1c1
Sequence:CCGGGCTCTTCCTTATAATTCCTTTCTCGAGAAAGGAATTATAAGGAAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010726.1-160s1c1
Sequence:CCGGCCTGAACAATTCCAGTATACTCTCGAGAGTATACTGGAATTGTTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010726.1-596s1c1
Sequence:CCGGGCAACCTAATTGTTTGTGCTTCTCGAGAAGCACAAACAATTAGGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314263    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010726.2-1248s21c1
Sequence:CCGGGAGGACATCAAAGCAAAGAAACTCGAGTTTCTTTGCTTTGATGTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314262    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010726.2-1224s21c1
Sequence:CCGGGCTCTTCCTTATAATTCCTTTCTCGAGAAAGGAATTATAAGGAAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010726
VALIDATED
PHYH MISSION shRNA shRNA Plasmid DNA
phytanoyl-CoA 2-hydroxylase
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000314260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010726.2-195s21c1
Sequence:CCGGCCTGAACAATTCCAGTATACTCTCGAGAGTATACTGGAATTGTTCAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000314261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010726.2-631s21c1
Sequence:CCGGGCAACCTAATTGTTTGTGCTTCTCGAGAAGCACAAACAATTAGGTTGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000183203    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010726.1-1213s1c1
Sequence:CCGGGAGGACATCAAAGCAAAGAAACTCGAGTTTCTTTGCTTTGATGTCCTCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000183360    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010726.1-1189s1c1
Sequence:CCGGGCTCTTCCTTATAATTCCTTTCTCGAGAAAGGAATTATAAGGAAGAGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000183409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010726.1-160s1c1
Sequence:CCGGCCTGAACAATTCCAGTATACTCTCGAGAGTATACTGGAATTGTTCAGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000183514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010726.1-596s1c1
Sequence:CCGGGCAACCTAATTGTTTGTGCTTCTCGAGAAGCACAAACAATTAGGTTGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000314263    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010726.2-1248s21c1
Sequence:CCGGGAGGACATCAAAGCAAAGAAACTCGAGTTTCTTTGCTTTGATGTCCTCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000314262    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010726.2-1224s21c1
Sequence:CCGGGCTCTTCCTTATAATTCCTTTCTCGAGAAAGGAATTATAAGGAAGAGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010726
VALIDATED
PHYH MISSION shRNA Lentiviral Transduction Particles
phytanoyl-CoA 2-hydroxylase
Mouse
8 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000314260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010726.2-195s21c1
Sequence:CCGGCCTGAACAATTCCAGTATACTCTCGAGAGTATACTGGAATTGTTCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010726.2-631s21c1
Sequence:CCGGGCAACCTAATTGTTTGTGCTTCTCGAGAAGCACAAACAATTAGGTTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183203    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010726.1-1213s1c1
Sequence:CCGGGAGGACATCAAAGCAAAGAAACTCGAGTTTCTTTGCTTTGATGTCCTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183360    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010726.1-1189s1c1
Sequence:CCGGGCTCTTCCTTATAATTCCTTTCTCGAGAAAGGAATTATAAGGAAGAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010726.1-160s1c1
Sequence:CCGGCCTGAACAATTCCAGTATACTCTCGAGAGTATACTGGAATTGTTCAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010726.1-596s1c1
Sequence:CCGGGCAACCTAATTGTTTGTGCTTCTCGAGAAGCACAAACAATTAGGTTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314263    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010726.2-1248s21c1
Sequence:CCGGGAGGACATCAAAGCAAAGAAACTCGAGTTTCTTTGCTTTGATGTCCTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314262    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010726.2-1224s21c1
Sequence:CCGGGCTCTTCCTTATAATTCCTTTCTCGAGAAAGGAATTATAAGGAAGAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006214
VALIDATED
PHYH MISSION shRNA Bacterial Glycerol Stock
phytanoyl-CoA 2-hydroxylase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000289089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_006214.3-460s21c1
Sequence:CCGGCCAGGAAGATAAGGAGCTCTTCTCGAGAAGAGCTCCTTATCTTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_006214.3-327s21c1
Sequence:CCGGGCTTTCGGAATGAGTTTGAAACTCGAGTTTCAAACTCATTCCGAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_006214.3-198s21c1
Sequence:CCGGCCAGTTTCCATCCTCAACAATCTCGAGATTGTTGAGGATGGAAACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_006214.2-1009s1c1
Sequence:CCGGGCGTGAACTTGAAGGATATTTCTCGAGAAATATCCTTCAAGTTCACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_006214.2-431s1c1
Sequence:CCGGCCAGGAAGATAAGGAGCTCTTCTCGAGAAGAGCTCCTTATCTTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006214.2-298s1c1
Sequence:CCGGGCTTTCGGAATGAGTTTGAAACTCGAGTTTCAAACTCATTCCGAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006214.2-169s1c1
Sequence:CCGGCCAGTTTCCATCCTCAACAATCTCGAGATTGTTGAGGATGGAAACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006214.2-848s1c1
Sequence:CCGGCCACGGATCTGGTCAGAATAACTCGAGTTATTCTGACCAGATCCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006214.3-1038s21c1
Sequence:CCGGGCGTGAACTTGAAGGATATTTCTCGAGAAATATCCTTCAAGTTCACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006214.3-877s21c1
Sequence:CCGGCCACGGATCTGGTCAGAATAACTCGAGTTATTCTGACCAGATCCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006214
VALIDATED
PHYH MISSION shRNA shRNA Plasmid DNA
phytanoyl-CoA 2-hydroxylase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000289089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_006214.3-460s21c1
Sequence:CCGGCCAGGAAGATAAGGAGCTCTTCTCGAGAAGAGCTCCTTATCTTCCTGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000289034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_006214.3-327s21c1
Sequence:CCGGGCTTTCGGAATGAGTTTGAAACTCGAGTTTCAAACTCATTCCGAAAGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000289035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_006214.3-198s21c1
Sequence:CCGGCCAGTTTCCATCCTCAACAATCTCGAGATTGTTGAGGATGGAAACTGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000063788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_006214.2-1009s1c1
Sequence:CCGGGCGTGAACTTGAAGGATATTTCTCGAGAAATATCCTTCAAGTTCACGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000063789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_006214.2-431s1c1
Sequence:CCGGCCAGGAAGATAAGGAGCTCTTCTCGAGAAGAGCTCCTTATCTTCCTGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000063791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006214.2-298s1c1
Sequence:CCGGGCTTTCGGAATGAGTTTGAAACTCGAGTTTCAAACTCATTCCGAAAGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000063792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006214.2-169s1c1
Sequence:CCGGCCAGTTTCCATCCTCAACAATCTCGAGATTGTTGAGGATGGAAACTGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000063790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006214.2-848s1c1
Sequence:CCGGCCACGGATCTGGTCAGAATAACTCGAGTTATTCTGACCAGATCCGTGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000289091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006214.3-1038s21c1
Sequence:CCGGGCGTGAACTTGAAGGATATTTCTCGAGAAATATCCTTCAAGTTCACGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000307026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006214.3-877s21c1
Sequence:CCGGCCACGGATCTGGTCAGAATAACTCGAGTTATTCTGACCAGATCCGTGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006214
VALIDATED
PHYH MISSION shRNA Lentiviral Transduction Particles
phytanoyl-CoA 2-hydroxylase
Human
10 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000289089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_006214.3-460s21c1
Sequence:CCGGCCAGGAAGATAAGGAGCTCTTCTCGAGAAGAGCTCCTTATCTTCCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_006214.3-327s21c1
Sequence:CCGGGCTTTCGGAATGAGTTTGAAACTCGAGTTTCAAACTCATTCCGAAAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_006214.3-198s21c1
Sequence:CCGGCCAGTTTCCATCCTCAACAATCTCGAGATTGTTGAGGATGGAAACTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_006214.2-1009s1c1
Sequence:CCGGGCGTGAACTTGAAGGATATTTCTCGAGAAATATCCTTCAAGTTCACGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_006214.2-431s1c1
Sequence:CCGGCCAGGAAGATAAGGAGCTCTTCTCGAGAAGAGCTCCTTATCTTCCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006214.2-298s1c1
Sequence:CCGGGCTTTCGGAATGAGTTTGAAACTCGAGTTTCAAACTCATTCCGAAAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006214.2-169s1c1
Sequence:CCGGCCAGTTTCCATCCTCAACAATCTCGAGATTGTTGAGGATGGAAACTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006214.2-848s1c1
Sequence:CCGGCCACGGATCTGGTCAGAATAACTCGAGTTATTCTGACCAGATCCGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006214.3-1038s21c1
Sequence:CCGGGCGTGAACTTGAAGGATATTTCTCGAGAAATATCCTTCAAGTTCACGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006214.3-877s21c1
Sequence:CCGGCCACGGATCTGGTCAGAATAACTCGAGTTATTCTGACCAGATCCGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)