EMAIL THIS PAGE TO A FRIEND

PHYHD1

phytanoyl-CoA dioxygenase domain containing 1

63 Gene Product Result for
Gene ID:
Mouse(227696) phytanoyl-CoA dioxygenase domain containing 1
Rat(296621) phytanoyl-CoA dioxygenase domain containing 1
domestic guinea pig(100724757) phytanoyl-CoA dioxygenase domain containing 1
naked mole-rat(101711786) phytanoyl-CoA dioxygenase domain containing 1
cow(540828) phytanoyl-CoA dioxygenase domain containing 1
sheep(101116814) phytanoyl-CoA dioxygenase domain containing 1
Zebrafish(492804) phytanoyl-CoA dioxygenase domain containing 1
chicken(417200) phytanoyl-CoA dioxygenase domain containing 1
domestic cat(101083302) phytanoyl-CoA dioxygenase domain containing 1
dog(608889) phytanoyl-CoA dioxygenase domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172267 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172267 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172267 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_174933 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_174933 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_174933 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU079421 MISSION® esiRNA targeting human PHYHD1 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001100876 Rosetta Predictions human pricing
NM_001100877 Rosetta Predictions human pricing
NM_174933 Rosetta Predictions human pricing
NM_001013081 Rosetta Predictions rat pricing
NM_172267 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100876 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00322437 predicted 1839
2 SASI_Hs02_00322438 predicted 1700
3 SASI_Hs02_00322439 predicted 1701
4 SASI_Hs02_00322440 predicted 1591
5 SASI_Hs02_00322441 predicted 1686
6 SASI_Hs02_00322442 predicted 1679
7 SASI_Hs02_00322443 predicted 1889
8 SASI_Hs02_00322444 predicted 1840
9 SASI_Hs02_00322445 predicted 1761
10 SASI_Hs02_00322446 predicted 1718
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100877 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00322447 predicted 887
2 SASI_Hs02_00322448 predicted 746
3 SASI_Hs02_00322449 predicted 748
4 SASI_Hs02_00322450 predicted 640
5 SASI_Hs02_00322451 predicted 734
6 SASI_Hs02_00322452 predicted 718
7 SASI_Hs02_00322453 predicted 934
8 SASI_Hs02_00322454 predicted 889
9 SASI_Hs02_00322455 predicted 807
10 SASI_Hs02_00322456 predicted 766
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174933 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00044212 predicted 1819
2 SASI_Hs01_00044214 predicted 1680
3 SASI_Hs02_00368864 predicted 1682
4 SASI_Hs01_00044216 predicted 1569
5 SASI_Hs02_00368865 predicted 1668
6 SASI_Hs01_00044217 predicted 1652
7 SASI_Hs01_00044218 predicted 1865
8 SASI_Hs02_00368866 predicted 1822
9 SASI_Hs02_00368867 predicted 1743
10 SASI_Hs02_00368868 predicted 1696
11 SASI_Hs01_00044210 predicted 648
12 SASI_Hs01_00044211 predicted 535
13 SASI_Hs01_00044213 predicted 774
14 SASI_Hs01_00044215 predicted 832
15 SASI_Hs01_00044219 predicted 938
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013081 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00072638 predicted 262
2 SASI_Rn01_00072639 predicted 346
3 SASI_Rn01_00072640 predicted 1006
4 SASI_Rn01_00072642 predicted 445
5 SASI_Rn01_00072643 predicted 254
6 SASI_Rn02_00200719 predicted 321
7 SASI_Rn01_00072644 predicted 225
8 SASI_Rn01_00072645 predicted 985
9 SASI_Rn01_00072646 predicted 478
10 SASI_Rn01_00072647 predicted 509
11 SASI_Rn01_00072641 predicted 1035
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172267 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00178389 predicted 219
2 SASI_Mm01_00178390 predicted 434
3 SASI_Mm02_00343737 predicted 398
4 SASI_Mm01_00178391 predicted 985
5 SASI_Mm01_00178392 predicted 924
6 SASI_Mm01_00178393 predicted 1077
7 SASI_Mm01_00178394 predicted 407
8 SASI_Mm01_00178395 predicted 1048
9 SASI_Mm01_00178397 predicted 537
10 SASI_Mm01_00178398 predicted 225
11 SASI_Mm01_00178396 predicted 1079
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172267
VALIDATED
PHYHD1 MISSION shRNA Bacterial Glycerol Stock
phytanoyl-CoA dioxygenase domain containing 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172267.2-342s1c1
Sequence:CCGGCGGTGACAAGATCCGATTCTTCTCGAGAAGAATCGGATCTTGTCACCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172267.2-859s1c1
Sequence:CCGGCATAAGAGTGAGCAGAACCATCTCGAGATGGTTCTGCTCACTCTTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192598    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172267.2-1089s1c1
Sequence:CCGGGCTTTCTTTCTGATGGTGTCTCTCGAGAGACACCATCAGAAAGAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192410    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172267.2-1077s1c1
Sequence:CCGGCTTCCTCTATGGGCTTTCTTTCTCGAGAAAGAAAGCCCATAGAGGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172267.1-636s1c1
Sequence:CCGGCAGGAAGATGAGCAACTTCAACTCGAGTTGAAGTTGCTCATCTTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172267.1-664s1c1
Sequence:CCGGGCAAGACAGACTACTTCTTGACTCGAGTCAAGAAGTAGTCTGTCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172267.1-693s1c1
Sequence:CCGGGACAAGATCCGATTCTTCTTTCTCGAGAAAGAAGAATCGGATCTTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172267.1-1190s1c1
Sequence:CCGGCCATGGAGAAGTGGTGCATAACTCGAGTTATGCACCACTTCTCCATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172267
VALIDATED
PHYHD1 MISSION shRNA shRNA Plasmid DNA
phytanoyl-CoA dioxygenase domain containing 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172267.2-342s1c1
Sequence:CCGGCGGTGACAAGATCCGATTCTTCTCGAGAAGAATCGGATCTTGTCACCGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000200921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172267.2-859s1c1
Sequence:CCGGCATAAGAGTGAGCAGAACCATCTCGAGATGGTTCTGCTCACTCTTATGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000192598    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172267.2-1089s1c1
Sequence:CCGGGCTTTCTTTCTGATGGTGTCTCTCGAGAGACACCATCAGAAAGAAAGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000192410    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172267.2-1077s1c1
Sequence:CCGGCTTCCTCTATGGGCTTTCTTTCTCGAGAAAGAAAGCCCATAGAGGAAGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000190439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172267.1-636s1c1
Sequence:CCGGCAGGAAGATGAGCAACTTCAACTCGAGTTGAAGTTGCTCATCTTCCTGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000190706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172267.1-664s1c1
Sequence:CCGGGCAAGACAGACTACTTCTTGACTCGAGTCAAGAAGTAGTCTGTCTTGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000192949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172267.1-693s1c1
Sequence:CCGGGACAAGATCCGATTCTTCTTTCTCGAGAAAGAAGAATCGGATCTTGTCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000202226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172267.1-1190s1c1
Sequence:CCGGCCATGGAGAAGTGGTGCATAACTCGAGTTATGCACCACTTCTCCATGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172267
VALIDATED
PHYHD1 MISSION shRNA Lentiviral Transduction Particles
phytanoyl-CoA dioxygenase domain containing 1
Mouse
8 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000201483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172267.2-342s1c1
Sequence:CCGGCGGTGACAAGATCCGATTCTTCTCGAGAAGAATCGGATCTTGTCACCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172267.2-859s1c1
Sequence:CCGGCATAAGAGTGAGCAGAACCATCTCGAGATGGTTCTGCTCACTCTTATGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192598    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172267.2-1089s1c1
Sequence:CCGGGCTTTCTTTCTGATGGTGTCTCTCGAGAGACACCATCAGAAAGAAAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192410    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172267.2-1077s1c1
Sequence:CCGGCTTCCTCTATGGGCTTTCTTTCTCGAGAAAGAAAGCCCATAGAGGAAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172267.1-636s1c1
Sequence:CCGGCAGGAAGATGAGCAACTTCAACTCGAGTTGAAGTTGCTCATCTTCCTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172267.1-664s1c1
Sequence:CCGGGCAAGACAGACTACTTCTTGACTCGAGTCAAGAAGTAGTCTGTCTTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172267.1-693s1c1
Sequence:CCGGGACAAGATCCGATTCTTCTTTCTCGAGAAAGAAGAATCGGATCTTGTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000202226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172267.1-1190s1c1
Sequence:CCGGCCATGGAGAAGTGGTGCATAACTCGAGTTATGCACCACTTCTCCATGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_174933
VALIDATED
PHYHD1 MISSION shRNA Bacterial Glycerol Stock
phytanoyl-CoA dioxygenase domain containing 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434990    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174933.3-1869s21c1
Sequence:CCGGGTTGCAACAGGGAGGTCTTGTCTCGAGACAAGACCTCCCTGTTGCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174933.2-706s1c1
Sequence:CCGGCCGGAGAAATCCATCAACAAACTCGAGTTTGTTGATGGATTTCTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_174933.2-517s1c1
Sequence:CCGGCAACAAAGGATTGGCGAGATACTCGAGTATCTCGCCAATCCTTTGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_174933.2-834s1c1
Sequence:CCGGGCAGAGCATGTACATCTTTAACTCGAGTTAAAGATGTACATGCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_174933.2-639s1c1
Sequence:CCGGTGGTGACAAGATTCGATTCTTCTCGAGAAGAATCGAATCTTGTCACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174933.3-996s21c1
Sequence:CCGGAGGATTCTTGTCTGCGGAAGACTCGAGTCTTCCGCAGACAAGAATCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222760    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_174933.2-1437s1c2
Sequence:CCGGCCCTAAGATCTTCACCTCTCTCTCGAGAGAGAGGTGAAGATCTTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174933.3-1823s21c1
Sequence:CCGGGGTGAAGCTGTGGGCTGTAAACTCGAGTTTACAGCCCACAGCTTCACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_174933
VALIDATED
PHYHD1 MISSION shRNA shRNA Plasmid DNA
phytanoyl-CoA dioxygenase domain containing 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434990    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174933.3-1869s21c1
Sequence:CCGGGTTGCAACAGGGAGGTCTTGTCTCGAGACAAGACCTCCCTGTTGCAACTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000078139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174933.2-706s1c1
Sequence:CCGGCCGGAGAAATCCATCAACAAACTCGAGTTTGTTGATGGATTTCTCCGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000078142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_174933.2-517s1c1
Sequence:CCGGCAACAAAGGATTGGCGAGATACTCGAGTATCTCGCCAATCCTTTGTTGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000078140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_174933.2-834s1c1
Sequence:CCGGGCAGAGCATGTACATCTTTAACTCGAGTTAAAGATGTACATGCTCTGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000078141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_174933.2-639s1c1
Sequence:CCGGTGGTGACAAGATTCGATTCTTCTCGAGAAGAATCGAATCTTGTCACCATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000437423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174933.3-996s21c1
Sequence:CCGGAGGATTCTTGTCTGCGGAAGACTCGAGTCTTCCGCAGACAAGAATCCTTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000222760    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_174933.2-1437s1c2
Sequence:CCGGCCCTAAGATCTTCACCTCTCTCTCGAGAGAGAGGTGAAGATCTTAGGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000424624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174933.3-1823s21c1
Sequence:CCGGGGTGAAGCTGTGGGCTGTAAACTCGAGTTTACAGCCCACAGCTTCACCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_174933
VALIDATED
PHYHD1 MISSION shRNA Lentiviral Transduction Particles
phytanoyl-CoA dioxygenase domain containing 1
Human
8 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000434990    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174933.3-1869s21c1
Sequence:CCGGGTTGCAACAGGGAGGTCTTGTCTCGAGACAAGACCTCCCTGTTGCAACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174933.2-706s1c1
Sequence:CCGGCCGGAGAAATCCATCAACAAACTCGAGTTTGTTGATGGATTTCTCCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_174933.2-517s1c1
Sequence:CCGGCAACAAAGGATTGGCGAGATACTCGAGTATCTCGCCAATCCTTTGTTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_174933.2-834s1c1
Sequence:CCGGGCAGAGCATGTACATCTTTAACTCGAGTTAAAGATGTACATGCTCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_174933.2-639s1c1
Sequence:CCGGTGGTGACAAGATTCGATTCTTCTCGAGAAGAATCGAATCTTGTCACCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174933.3-996s21c1
Sequence:CCGGAGGATTCTTGTCTGCGGAAGACTCGAGTCTTCCGCAGACAAGAATCCTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000222760    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_174933.2-1437s1c2
Sequence:CCGGCCCTAAGATCTTCACCTCTCTCTCGAGAGAGAGGTGAAGATCTTAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174933.3-1823s21c1
Sequence:CCGGGGTGAAGCTGTGGGCTGTAAACTCGAGTTTACAGCCCACAGCTTCACCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)