EMAIL THIS PAGE TO A FRIEND

PHYHIP

phytanoyl-CoA 2-hydroxylase interacting protein

77 Gene Product Result for
Synonyms: DYRK1AP3 PAHX-AP PAHXAP1
UniProtKB ID: Q92561, D3DSR1, Q8N4I9
Gene ID:
Mouse(105653) phytanoyl-CoA hydroxylase interacting protein
Rat(290356) phytanoyl-CoA 2-hydroxylase interacting protein
Horse(100056996) phytanoyl-CoA 2-hydroxylase interacting protein
domestic cat(101089097) phytanoyl-CoA 2-hydroxylase interacting protein
dog(486126) phytanoyl-CoA 2-hydroxylase interacting protein
cow(616243) phytanoyl-CoA 2-hydroxylase interacting protein
sheep(101122084) phytanoyl-CoA 2-hydroxylase interacting protein
naked mole-rat(101714848) phytanoyl-CoA 2-hydroxylase interacting protein
Domestic Rabbit(100356507) phytanoyl-CoA 2-hydroxylase interacting protein
domestic guinea pig(100729316) phytanoyl-CoA 2-hydroxylase interacting protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014759 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014759 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014759 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145981 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145981 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145981 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001099335 Rosetta Predictions human pricing
NM_014759 Rosetta Predictions human pricing
NM_001017376 Rosetta Predictions rat pricing
NM_145981 Rosetta Predictions mouse pricing
XM_895316 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099335 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00320479 predicted 1313
2 SASI_Hs02_00320480 predicted 899
3 SASI_Hs02_00320481 predicted 1167
4 SASI_Hs02_00320482 predicted 1101
5 SASI_Hs02_00320483 predicted 1947
6 SASI_Hs02_00320484 predicted 716
7 SASI_Hs02_00320485 predicted 1826
8 SASI_Hs02_00320486 predicted 820
9 SASI_Hs02_00320487 predicted 2058
10 SASI_Hs02_00320488 predicted 1091
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014759 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00182710 predicted 1827
2 SASI_Hs01_00182712 predicted 1193
3 SASI_Hs01_00182713 predicted 1703
4 SASI_Hs01_00182714 predicted 769
5 SASI_Hs02_00346233 predicted 977
6 SASI_Hs02_00346234 predicted 1933
7 SASI_Hs01_00182716 predicted 1048
8 SASI_Hs01_00182718 predicted 961
9 SASI_Hs02_00346235 predicted 1486
10 SASI_Hs02_00346236 predicted 1204
11 SASI_Hs01_00182711 predicted 347
12 SASI_Hs01_00182715 predicted 461
13 SASI_Hs01_00182717 predicted 1351
14 SASI_Hs01_00182719 predicted 877
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017376 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00030384 predicted 383
2 SASI_Rn01_00030385 predicted 497
3 SASI_Rn01_00030388 predicted 535
4 SASI_Rn01_00030389 predicted 820
5 SASI_Rn02_00202212 predicted 1622
6 SASI_Rn01_00030391 predicted 831
7 SASI_Rn01_00030392 predicted 1062
8 SASI_Rn02_00202213 predicted 1129
9 SASI_Rn02_00202214 predicted 544
10 SASI_Rn02_00202215 predicted 844
11 SASI_Rn01_00030386 predicted 763
12 SASI_Rn01_00030387 predicted 344
13 SASI_Rn01_00030390 predicted 698
14 SASI_Rn01_00030393 predicted 774
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145981 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00341482 predicted 397
2 SASI_Mm02_00341483 predicted 1408
3 SASI_Mm02_00341484 predicted 505
4 SASI_Mm02_00341485 predicted 1256
5 SASI_Mm02_00341486 predicted 1220
6 SASI_Mm02_00341487 predicted 549
7 SASI_Mm02_00341488 predicted 773
8 SASI_Mm02_00341489 predicted 345
9 SASI_Mm02_00341490 predicted 987
10 SASI_Mm02_00341491 predicted 345
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_895316 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00266886 predicted 533
2 SASI_Mm01_00266887 predicted 346
3 SASI_Mm01_00266888 predicted 1470
4 SASI_Mm01_00266889 predicted 652
5 SASI_Mm01_00266890 predicted 1405
6 SASI_Mm01_00266891 predicted 263
7 SASI_Mm01_00266892 predicted 690
8 SASI_Mm01_00266893 predicted 844
9 SASI_Mm01_00266894 predicted 916
10 SASI_Mm01_00266895 predicted 488
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014759
PHYHIP MISSION shRNA Bacterial Glycerol Stock
phytanoyl-CoA 2-hydroxylase interacting protein
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000444723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014759.3-1123s21c1
Sequence:CCGGTCAGCTGCAACACGGAGTTCACTCGAGTGAACTCCGTGTTGCAGCTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014759.3-1054s21c1
Sequence:CCGGAGCCTTACCTGAAGGACAACACTCGAGTGTTGTCCTTCAGGTAAGGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014759.2-430s1c1
Sequence:CCGGCCATTACTTCATTGACCTTAACTCGAGTTAAGGTCAATGAAGTAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014759.2-439s1c1
Sequence:CCGGCATTGACCTTAACAAGAAGGACTCGAGTCCTTCTTGTTAAGGTCAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167466    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014759.2-1833s1c1
Sequence:CCGGGATCCCTTCCTTCTATAAATACTCGAGTATTTATAGAAGGAAGGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014759.2-751s1c1
Sequence:CCGGCAACCATCACAAGGAGTACTTCTCGAGAAGTACTCCTTGTGATGGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014759.2-1093s1c1
Sequence:CCGGCCTGGACATTGCTTGCAACAACTCGAGTTGTTGCAAGCAATGTCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438426    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014759.3-1720s21c1
Sequence:CCGGACGGTGGTCCTCTTGGTAAGTCTCGAGACTTACCAAGAGGACCACCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014759.3-1228s21c1
Sequence:CCGGACCTCTACTTTGCGGACTTCTCTCGAGAGAAGTCCGCAAAGTAGAGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014759.2-1174s1c1
Sequence:CCGGCCTGGAGATCATCTACACTGACTCGAGTCAGTGTAGATGATCTCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014759
PHYHIP MISSION shRNA shRNA Plasmid DNA
phytanoyl-CoA 2-hydroxylase interacting protein
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000444723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014759.3-1123s21c1
Sequence:CCGGTCAGCTGCAACACGGAGTTCACTCGAGTGAACTCCGTGTTGCAGCTGATTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000414163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014759.3-1054s21c1
Sequence:CCGGAGCCTTACCTGAAGGACAACACTCGAGTGTTGTCCTTCAGGTAAGGCTTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000167078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014759.2-430s1c1
Sequence:CCGGCCATTACTTCATTGACCTTAACTCGAGTTAAGGTCAATGAAGTAATGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000167097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014759.2-439s1c1
Sequence:CCGGCATTGACCTTAACAAGAAGGACTCGAGTCCTTCTTGTTAAGGTCAATGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000167466    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014759.2-1833s1c1
Sequence:CCGGGATCCCTTCCTTCTATAAATACTCGAGTATTTATAGAAGGAAGGGATCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000168819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014759.2-751s1c1
Sequence:CCGGCAACCATCACAAGGAGTACTTCTCGAGAAGTACTCCTTGTGATGGTTGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000173019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014759.2-1093s1c1
Sequence:CCGGCCTGGACATTGCTTGCAACAACTCGAGTTGTTGCAAGCAATGTCCAGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000438426    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014759.3-1720s21c1
Sequence:CCGGACGGTGGTCCTCTTGGTAAGTCTCGAGACTTACCAAGAGGACCACCGTTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000426405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014759.3-1228s21c1
Sequence:CCGGACCTCTACTTTGCGGACTTCTCTCGAGAGAAGTCCGCAAAGTAGAGGTTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000172426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014759.2-1174s1c1
Sequence:CCGGCCTGGAGATCATCTACACTGACTCGAGTCAGTGTAGATGATCTCCAGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014759
PHYHIP MISSION shRNA Lentiviral Transduction Particles
phytanoyl-CoA 2-hydroxylase interacting protein
Human
10 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000444723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014759.3-1123s21c1
Sequence:CCGGTCAGCTGCAACACGGAGTTCACTCGAGTGAACTCCGTGTTGCAGCTGATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014759.3-1054s21c1
Sequence:CCGGAGCCTTACCTGAAGGACAACACTCGAGTGTTGTCCTTCAGGTAAGGCTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014759.2-430s1c1
Sequence:CCGGCCATTACTTCATTGACCTTAACTCGAGTTAAGGTCAATGAAGTAATGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014759.2-439s1c1
Sequence:CCGGCATTGACCTTAACAAGAAGGACTCGAGTCCTTCTTGTTAAGGTCAATGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167466    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014759.2-1833s1c1
Sequence:CCGGGATCCCTTCCTTCTATAAATACTCGAGTATTTATAGAAGGAAGGGATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014759.2-751s1c1
Sequence:CCGGCAACCATCACAAGGAGTACTTCTCGAGAAGTACTCCTTGTGATGGTTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014759.2-1093s1c1
Sequence:CCGGCCTGGACATTGCTTGCAACAACTCGAGTTGTTGCAAGCAATGTCCAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438426    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014759.3-1720s21c1
Sequence:CCGGACGGTGGTCCTCTTGGTAAGTCTCGAGACTTACCAAGAGGACCACCGTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014759.3-1228s21c1
Sequence:CCGGACCTCTACTTTGCGGACTTCTCTCGAGAGAAGTCCGCAAAGTAGAGGTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014759.2-1174s1c1
Sequence:CCGGCCTGGAGATCATCTACACTGACTCGAGTCAGTGTAGATGATCTCCAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145981
PHYHIP MISSION shRNA Bacterial Glycerol Stock
phytanoyl-CoA 2-hydroxylase interacting protein
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000250495    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145981.3-2423s21c1
Sequence:CCGGGGGATTGTCATAGTAACATTTCTCGAGAAATGTTACTATGACAATCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145981.3-954s21c1
Sequence:CCGGCCAGCACCAACCTCTACTTTGCTCGAGCAAAGTAGAGGTTGGTGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145981.3-353s21c1
Sequence:CCGGACCTGTGACTCTTTCCGTATCCTCGAGGATACGGAAAGAGTCACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145981.3-399s21c1
Sequence:CCGGTGGAGAGGGTCACCCATTATTCTCGAGAATAATGGGTGACCCTCTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145981.3-990s21c1
Sequence:CCGGTGTACACAGCCTACCACTATGCTCGAGCATAGTGGTAGGCTGTGTACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145981
PHYHIP MISSION shRNA shRNA Plasmid DNA
phytanoyl-CoA 2-hydroxylase interacting protein
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000250495    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145981.3-2423s21c1
Sequence:CCGGGGGATTGTCATAGTAACATTTCTCGAGAAATGTTACTATGACAATCCCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000250494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145981.3-954s21c1
Sequence:CCGGCCAGCACCAACCTCTACTTTGCTCGAGCAAAGTAGAGGTTGGTGCTGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000258066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145981.3-353s21c1
Sequence:CCGGACCTGTGACTCTTTCCGTATCCTCGAGGATACGGAAAGAGTCACAGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000250493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145981.3-399s21c1
Sequence:CCGGTGGAGAGGGTCACCCATTATTCTCGAGAATAATGGGTGACCCTCTCCATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000250492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145981.3-990s21c1
Sequence:CCGGTGTACACAGCCTACCACTATGCTCGAGCATAGTGGTAGGCTGTGTACATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145981
PHYHIP MISSION shRNA Lentiviral Transduction Particles
phytanoyl-CoA 2-hydroxylase interacting protein
Mouse
5 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000250495    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145981.3-2423s21c1
Sequence:CCGGGGGATTGTCATAGTAACATTTCTCGAGAAATGTTACTATGACAATCCCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145981.3-954s21c1
Sequence:CCGGCCAGCACCAACCTCTACTTTGCTCGAGCAAAGTAGAGGTTGGTGCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000258066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145981.3-353s21c1
Sequence:CCGGACCTGTGACTCTTTCCGTATCCTCGAGGATACGGAAAGAGTCACAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145981.3-399s21c1
Sequence:CCGGTGGAGAGGGTCACCCATTATTCTCGAGAATAATGGGTGACCCTCTCCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145981.3-990s21c1
Sequence:CCGGTGTACACAGCCTACCACTATGCTCGAGCATAGTGGTAGGCTGTGTACATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)