EMAIL THIS PAGE TO A FRIEND

PHYHIPL

phytanoyl-CoA 2-hydroxylase interacting protein-like

147 Gene Product Result for
Gene ID:
Mouse(70911) phytanoyl-CoA hydroxylase interacting protein-like
Rat(309901) phytanoyl-CoA 2-hydroxylase interacting protein-like
domestic guinea pig(100736227) phytanoyl-CoA 2-hydroxylase interacting protein-like
naked mole-rat(101723406) phytanoyl-CoA 2-hydroxylase interacting protein-like
cow(780878) phytanoyl-CoA 2-hydroxylase interacting protein-like
chicken(423603) phytanoyl-CoA 2-hydroxylase interacting protein-like
Horse(100072214) phytanoyl-CoA 2-hydroxylase interacting protein-like
domestic cat(101096918) phytanoyl-CoA 2-hydroxylase interacting protein-like
dog(479214) phytanoyl-CoA 2-hydroxylase interacting protein-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178621 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178621 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178621 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032439 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032439 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032439 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032439 Rosetta Predictions human pricing
NM_001012076 Rosetta Predictions rat pricing
XM_574744 Rosetta Predictions rat pricing
NM_178621 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032439 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00359851 predicted 493
2 SASI_Hs01_00192459 predicted 729
3 SASI_Hs01_00192461 predicted 538
4 SASI_Hs01_00192462 predicted 999
5 SASI_Hs02_00359852 predicted 402
6 SASI_Hs01_00192463 predicted 956
7 SASI_Hs01_00192464 predicted 1076
8 SASI_Hs01_00192465 predicted 601
9 SASI_Hs01_00192466 predicted 781
10 SASI_Hs01_00192467 predicted 1310
11 SASI_Hs01_00192458 predicted 1021
12 SASI_Hs01_00192460 predicted 1092
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012076 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00067631 predicted 480
2 SASI_Rn01_00067632 predicted 757
3 SASI_Rn01_00067633 predicted 499
4 SASI_Rn01_00067634 predicted 227
5 SASI_Rn01_00067636 predicted 1246
6 SASI_Rn01_00067638 predicted 844
7 SASI_Rn01_00067639 predicted 569
8 SASI_Rn01_00067640 predicted 570
9 SASI_Rn02_00200192 predicted 1082
10 SASI_Rn02_00200193 predicted 1207
11 SASI_Rn01_00067635 predicted 494
12 SASI_Rn01_00067637 predicted 626
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574744 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00186886 predicted 884
2 SASI_Rn01_00186887 predicted 1406
3 SASI_Rn01_00186888 predicted 835
4 SASI_Rn01_00186889 predicted 882
5 SASI_Rn01_00186890 predicted 1395
6 SASI_Rn01_00186891 predicted 1474
7 SASI_Rn01_00186892 predicted 844
8 SASI_Rn01_00186893 predicted 1443
9 SASI_Rn01_00186894 predicted 1399
10 SASI_Rn01_00186895 predicted 1397
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178621 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00188899 predicted 351
2 SASI_Mm01_00188901 predicted 642
3 SASI_Mm01_00188902 predicted 1389
4 SASI_Mm01_00188903 predicted 743
5 SASI_Mm01_00188904 predicted 979
6 SASI_Mm01_00188905 predicted 443
7 SASI_Mm01_00188906 predicted 1355
8 SASI_Mm01_00188907 predicted 648
9 SASI_Mm01_00188908 predicted 660
10 SASI_Mm02_00348984 predicted 508
11 SASI_Mm01_00188900 predicted 1225
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178621
PHYHIPL MISSION shRNA Bacterial Glycerol Stock
phytanoyl-CoA 2-hydroxylase interacting protein-like
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000249025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178621.3-986s21c1
Sequence:CCGGTATGTACACGGCTTATCATTACTCGAGTAATGATAAGCCGTGTACATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178621.2-760s1c1
Sequence:CCGGGTGAGAGAACACTATGGGAATCTCGAGATTCCCATAGTGTTCTCTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178621.3-1135s21c1
Sequence:CCGGACCACGCCCAGGATGTCATTTCTCGAGAAATGACATCCTGGGCGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174821    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178621.2-1549s1c1
Sequence:CCGGGCCAAACATAACAAGACAGTTCTCGAGAACTGTCTTGTTATGTTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178621.3-1058s21c1
Sequence:CCGGGCAGCGCCTTCCTCAACTAAACTCGAGTTTAGTTGAGGAAGGCGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178621.3-262s21c1
Sequence:CCGGGCGACCGTGATGGTAACAAATCTCGAGATTTGTTACCATCACGGTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257850    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178621.3-1684s21c1
Sequence:CCGGTAATTGCAGCATGAGTTAAATCTCGAGATTTAACTCATGCTGCAATTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178621
PHYHIPL MISSION shRNA shRNA Plasmid DNA
phytanoyl-CoA 2-hydroxylase interacting protein-like
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000249025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178621.3-986s21c1
Sequence:CCGGTATGTACACGGCTTATCATTACTCGAGTAATGATAAGCCGTGTACATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178621.2-760s1c1
Sequence:CCGGGTGAGAGAACACTATGGGAATCTCGAGATTCCCATAGTGTTCTCTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178621.3-1135s21c1
Sequence:CCGGACCACGCCCAGGATGTCATTTCTCGAGAAATGACATCCTGGGCGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174821    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178621.2-1549s1c1
Sequence:CCGGGCCAAACATAACAAGACAGTTCTCGAGAACTGTCTTGTTATGTTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178621.3-1058s21c1
Sequence:CCGGGCAGCGCCTTCCTCAACTAAACTCGAGTTTAGTTGAGGAAGGCGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178621.3-262s21c1
Sequence:CCGGGCGACCGTGATGGTAACAAATCTCGAGATTTGTTACCATCACGGTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257850    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178621.3-1684s21c1
Sequence:CCGGTAATTGCAGCATGAGTTAAATCTCGAGATTTAACTCATGCTGCAATTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178621
PHYHIPL MISSION shRNA Lentiviral Transduction Particles
phytanoyl-CoA 2-hydroxylase interacting protein-like
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000249025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178621.3-986s21c1
Sequence:CCGGTATGTACACGGCTTATCATTACTCGAGTAATGATAAGCCGTGTACATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178621.2-760s1c1
Sequence:CCGGGTGAGAGAACACTATGGGAATCTCGAGATTCCCATAGTGTTCTCTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178621.3-1135s21c1
Sequence:CCGGACCACGCCCAGGATGTCATTTCTCGAGAAATGACATCCTGGGCGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174821    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178621.2-1549s1c1
Sequence:CCGGGCCAAACATAACAAGACAGTTCTCGAGAACTGTCTTGTTATGTTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178621.3-1058s21c1
Sequence:CCGGGCAGCGCCTTCCTCAACTAAACTCGAGTTTAGTTGAGGAAGGCGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178621.3-262s21c1
Sequence:CCGGGCGACCGTGATGGTAACAAATCTCGAGATTTGTTACCATCACGGTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257850    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178621.3-1684s21c1
Sequence:CCGGTAATTGCAGCATGAGTTAAATCTCGAGATTTAACTCATGCTGCAATTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032439
PHYHIPL MISSION shRNA Bacterial Glycerol Stock
phytanoyl-CoA 2-hydroxylase interacting protein-like
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000134787    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032439.1-2239s1c1
Sequence:CCGGCCCATCCAAACTATAAGAGAACTCGAGTTCTCTTATAGTTTGGATGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032439.1-1376s1c1
Sequence:CCGGGTAATATCAGTGTTGGACGTTCTCGAGAACGTCCAACACTGATATTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134499    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032439.1-2198s1c1
Sequence:CCGGGCCTCTGAAATAAGTCTGTTTCTCGAGAAACAGACTTATTTCAGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032439.1-889s1c1
Sequence:CCGGCCATCTGTCAAGGATAACAGTCTCGAGACTGTTATCCTTGACAGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032439.1-863s1c1
Sequence:CCGGGAGAACATCATGGGAATGCTACTCGAGTAGCATTCCCATGATGTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032439.1-642s1c1
Sequence:CCGGCCCAAGAACTGAATATACAGTCTCGAGACTGTATATTCAGTTCTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032439.3-1085s21c1
Sequence:CCGGTATGTACACTGCTTATCATTACTCGAGTAATGATAAGCAGTGTACATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032439.3-497s21c1
Sequence:CCGGGGATCGCATTACACACTATTTCTCGAGAAATAGTGTGTAATGCGATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415158    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032439.3-1598s21c1
Sequence:CCGGTGATGAAATACCCTAAGTTAACTCGAGTTAACTTAGGGTATTTCATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032439
PHYHIPL MISSION shRNA shRNA Plasmid DNA
phytanoyl-CoA 2-hydroxylase interacting protein-like
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000134787    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032439.1-2239s1c1
Sequence:CCGGCCCATCCAAACTATAAGAGAACTCGAGTTCTCTTATAGTTTGGATGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032439.1-1376s1c1
Sequence:CCGGGTAATATCAGTGTTGGACGTTCTCGAGAACGTCCAACACTGATATTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134499    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032439.1-2198s1c1
Sequence:CCGGGCCTCTGAAATAAGTCTGTTTCTCGAGAAACAGACTTATTTCAGAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032439.1-889s1c1
Sequence:CCGGCCATCTGTCAAGGATAACAGTCTCGAGACTGTTATCCTTGACAGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032439.1-863s1c1
Sequence:CCGGGAGAACATCATGGGAATGCTACTCGAGTAGCATTCCCATGATGTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032439.1-642s1c1
Sequence:CCGGCCCAAGAACTGAATATACAGTCTCGAGACTGTATATTCAGTTCTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032439.3-1085s21c1
Sequence:CCGGTATGTACACTGCTTATCATTACTCGAGTAATGATAAGCAGTGTACATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032439.3-497s21c1
Sequence:CCGGGGATCGCATTACACACTATTTCTCGAGAAATAGTGTGTAATGCGATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415158    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032439.3-1598s21c1
Sequence:CCGGTGATGAAATACCCTAAGTTAACTCGAGTTAACTTAGGGTATTTCATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032439
PHYHIPL MISSION shRNA Lentiviral Transduction Particles
phytanoyl-CoA 2-hydroxylase interacting protein-like
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000134787    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032439.1-2239s1c1
Sequence:CCGGCCCATCCAAACTATAAGAGAACTCGAGTTCTCTTATAGTTTGGATGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032439.1-1376s1c1
Sequence:CCGGGTAATATCAGTGTTGGACGTTCTCGAGAACGTCCAACACTGATATTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134499    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032439.1-2198s1c1
Sequence:CCGGGCCTCTGAAATAAGTCTGTTTCTCGAGAAACAGACTTATTTCAGAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032439.1-889s1c1
Sequence:CCGGCCATCTGTCAAGGATAACAGTCTCGAGACTGTTATCCTTGACAGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032439.1-863s1c1
Sequence:CCGGGAGAACATCATGGGAATGCTACTCGAGTAGCATTCCCATGATGTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032439.1-642s1c1
Sequence:CCGGCCCAAGAACTGAATATACAGTCTCGAGACTGTATATTCAGTTCTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032439.3-1085s21c1
Sequence:CCGGTATGTACACTGCTTATCATTACTCGAGTAATGATAAGCAGTGTACATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032439.3-497s21c1
Sequence:CCGGGGATCGCATTACACACTATTTCTCGAGAAATAGTGTGTAATGCGATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415158    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032439.3-1598s21c1
Sequence:CCGGTGATGAAATACCCTAAGTTAACTCGAGTTAACTTAGGGTATTTCATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)