EMAIL THIS PAGE TO A FRIEND

PHYKPL

5-phosphohydroxy-L-lysine phospho-lyase

58 Gene Product Result for
Synonyms: AGXT2L2 PHLU
UniProtKB ID: Q8IUZ5, B3KN36, D3DWP9, Q8WYS6, Q96HW8
Gene ID:
Human(85007) Summary: This is a nuclear gene encoding a mitochondrial enzyme that catalyzes the conversion of 5-phosphonooxy-L-lysine to ammonia, inorganic phosphate, and 2-aminoadipate semialdehyde. Mutations in this gene may cause phosphohydroxylysinuria. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]
Mouse(72947) 5-phosphohydroxy-L-lysine phospholyase
Rat(100169747) 5-phosphohydroxy-L-lysine phospho-lyase
naked mole-rat(101713270) 5-phosphohydroxy-L-lysine phospho-lyase
domestic guinea pig(100724331) 5-phosphohydroxy-L-lysine phospho-lyase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032921 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032921 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032921 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028398 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028398 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028398 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU089301 MISSION® esiRNA targeting human PHYKPL human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032921 Rosetta Predictions human pricing
NM_153373 Rosetta Predictions human pricing
NM_001128196 Rosetta Predictions rat pricing
NM_028398 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032921 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00037709 predicted 1226
2 SASI_Hs01_00037710 predicted 1039
3 SASI_Hs01_00037711 predicted 930
4 SASI_Hs01_00037712 predicted 1272
5 SASI_Hs01_00037713 predicted 1072
6 SASI_Hs01_00037714 predicted 1101
7 SASI_Hs01_00037715 predicted 1250
8 SASI_Hs01_00037716 predicted 1138
9 SASI_Hs01_00037717 predicted 1027
10 SASI_Hs01_00037718 predicted 964
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153373 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00011459 predicted 1450
2 SASI_Hs02_00367256 predicted 368
3 SASI_Hs01_00011461 predicted 1674
4 SASI_Hs02_00367257 predicted 1619
5 SASI_Hs02_00367258 predicted 629
6 SASI_Hs02_00367259 predicted 911
7 SASI_Hs02_00367260 predicted 669
8 SASI_Hs02_00367261 predicted 1390
9 SASI_Hs02_00367262 predicted 1370
10 SASI_Hs02_00367263 predicted 1679
11 SASI_Hs01_00011458 predicted 1631
12 SASI_Hs01_00011460 predicted 1342
13 SASI_Hs01_00011462 predicted 1470
14 SASI_Hs01_00011463 predicted 1509
15 SASI_Hs01_00011464 predicted 1658
16 SASI_Hs01_00011465 predicted 1546
17 SASI_Hs01_00011466 predicted 1432
18 SASI_Hs01_00011467 predicted 1375
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128196 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00255140 predicted 893
2 SASI_Rn02_00255141 predicted 1217
3 SASI_Rn02_00255142 predicted 1161
4 SASI_Rn02_00255143 predicted 1247
5 SASI_Rn02_00255144 predicted 314
6 SASI_Rn02_00255145 predicted 422
7 SASI_Rn02_00255146 predicted 1007
8 SASI_Rn02_00255147 predicted 1058
9 SASI_Rn02_00255148 predicted 416
10 SASI_Rn02_00255149 predicted 924
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028398 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00167166 predicted 951
2 SASI_Mm01_00167168 predicted 1297
3 SASI_Mm01_00167169 predicted 1070
4 SASI_Mm01_00167170 predicted 1198
5 SASI_Mm02_00333800 predicted 1267
6 SASI_Mm01_00167171 predicted 854
7 SASI_Mm01_00167172 predicted 463
8 SASI_Mm01_00167173 predicted 1415
9 SASI_Mm01_00167174 predicted 500
10 SASI_Mm01_00167175 predicted 1322
11 SASI_Mm01_00167167 predicted 1340
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032921
VALIDATED
PHYKPL MISSION shRNA Bacterial Glycerol Stock
5-phosphohydroxy-L-lysine phospho-lyase
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_032921.1-795s1c1
Sequence:CCGGCCTGAATGTCTTGGAGAAGGACTCGAGTCCTTCTCCAAGACATTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151788    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032921.1-1196s1c1
Sequence:CCGGCTAAGTGTACTCCAGAAGAAACTCGAGTTTCTTCTGGAGTACACTTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_032921.1-1041s1c1
Sequence:CCGGGAGGAACATCCTGAAGTTTAACTCGAGTTAAACTTCAGGATGTTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_032921.1-1117s1c1
Sequence:CCGGGCCATTCTGACTGACATGGAACTCGAGTTCCATGTCAGTCAGAATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_032921.1-736s1c1
Sequence:CCGGGTTGAGTACTTCAACACGTTTCTCGAGAAACGTGTTGAAGTACTCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032921
VALIDATED
PHYKPL MISSION shRNA shRNA Plasmid DNA
5-phosphohydroxy-L-lysine phospho-lyase
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_032921.1-795s1c1
Sequence:CCGGCCTGAATGTCTTGGAGAAGGACTCGAGTCCTTCTCCAAGACATTCAGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000151788    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032921.1-1196s1c1
Sequence:CCGGCTAAGTGTACTCCAGAAGAAACTCGAGTTTCTTCTGGAGTACACTTAGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000150658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_032921.1-1041s1c1
Sequence:CCGGGAGGAACATCCTGAAGTTTAACTCGAGTTAAACTTCAGGATGTTCCTCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000155023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_032921.1-1117s1c1
Sequence:CCGGGCCATTCTGACTGACATGGAACTCGAGTTCCATGTCAGTCAGAATGGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000151359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_032921.1-736s1c1
Sequence:CCGGGTTGAGTACTTCAACACGTTTCTCGAGAAACGTGTTGAAGTACTCAACTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032921
VALIDATED
PHYKPL MISSION shRNA Lentiviral Transduction Particles
5-phosphohydroxy-L-lysine phospho-lyase
Human
5 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000155771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_032921.1-795s1c1
Sequence:CCGGCCTGAATGTCTTGGAGAAGGACTCGAGTCCTTCTCCAAGACATTCAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151788    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_032921.1-1196s1c1
Sequence:CCGGCTAAGTGTACTCCAGAAGAAACTCGAGTTTCTTCTGGAGTACACTTAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_032921.1-1041s1c1
Sequence:CCGGGAGGAACATCCTGAAGTTTAACTCGAGTTAAACTTCAGGATGTTCCTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_032921.1-1117s1c1
Sequence:CCGGGCCATTCTGACTGACATGGAACTCGAGTTCCATGTCAGTCAGAATGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_032921.1-736s1c1
Sequence:CCGGGTTGAGTACTTCAACACGTTTCTCGAGAAACGTGTTGAAGTACTCAACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028398
VALIDATED
PHYKPL MISSION shRNA Bacterial Glycerol Stock
5-phosphohydroxy-L-lysine phospho-lyase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000120404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028398.1-982s1c1
Sequence:CCGGGCAGTCCTAGATGTCTTGAAACTCGAGTTTCAAGACATCTAGGACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028398.1-1159s1c1
Sequence:CCGGGCAACTGAAGAGGCGGAATATCTCGAGATATTCCGCCTCTTCAGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120402    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028398.1-1456s1c1
Sequence:CCGGCTTCACTGGATTGGTGAACTACTCGAGTAGTTCACCAATCCAGTGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028398.1-418s1c1
Sequence:CCGGGTGGTATTAGACCATGCTTATCTCGAGATAAGCATGGTCTAATACCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028398.1-273s1c1
Sequence:CCGGGCATGACAACATCGTGGACTACTCGAGTAGTCCACGATGTTGTCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028398
VALIDATED
PHYKPL MISSION shRNA shRNA Plasmid DNA
5-phosphohydroxy-L-lysine phospho-lyase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000120404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028398.1-982s1c1
Sequence:CCGGGCAGTCCTAGATGTCTTGAAACTCGAGTTTCAAGACATCTAGGACTGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000120406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028398.1-1159s1c1
Sequence:CCGGGCAACTGAAGAGGCGGAATATCTCGAGATATTCCGCCTCTTCAGTTGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000120402    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028398.1-1456s1c1
Sequence:CCGGCTTCACTGGATTGGTGAACTACTCGAGTAGTTCACCAATCCAGTGAAGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000120405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028398.1-418s1c1
Sequence:CCGGGTGGTATTAGACCATGCTTATCTCGAGATAAGCATGGTCTAATACCACTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000120403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028398.1-273s1c1
Sequence:CCGGGCATGACAACATCGTGGACTACTCGAGTAGTCCACGATGTTGTCATGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028398
VALIDATED
PHYKPL MISSION shRNA Lentiviral Transduction Particles
5-phosphohydroxy-L-lysine phospho-lyase
Mouse
5 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000120404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028398.1-982s1c1
Sequence:CCGGGCAGTCCTAGATGTCTTGAAACTCGAGTTTCAAGACATCTAGGACTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028398.1-1159s1c1
Sequence:CCGGGCAACTGAAGAGGCGGAATATCTCGAGATATTCCGCCTCTTCAGTTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120402    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028398.1-1456s1c1
Sequence:CCGGCTTCACTGGATTGGTGAACTACTCGAGTAGTTCACCAATCCAGTGAAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028398.1-418s1c1
Sequence:CCGGGTGGTATTAGACCATGCTTATCTCGAGATAAGCATGGTCTAATACCACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028398.1-273s1c1
Sequence:CCGGGCATGACAACATCGTGGACTACTCGAGTAGTCCACGATGTTGTCATGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)