EMAIL THIS PAGE TO A FRIEND

PI15

peptidase inhibitor 15

141 Gene Product Result for
Synonyms: CRISP8 P24TI P25TI
UniProtKB ID: O43692, Q68CY1
Gene ID:
Human(51050) Summary: This gene encodes a trypsin inhibitor. The protein shares similarity to insect venom allergens, mammalian testis-specific proteins and plant pathogenesis-related proteins. It is frequently expressed in human neuroblastoma and glioblastoma cell lines, and thus may play a role in the central nervous system. [provided by RefSeq, Jul 2008]
Mouse(94227) peptidase inhibitor 15
Rat(301489) peptidase inhibitor 15
chicken(374241) peptidase inhibitor 15
dog(487003) peptidase inhibitor 15
domestic cat(101082374) peptidase inhibitor 15
domestic guinea pig(100712710) peptidase inhibitor 15
naked mole-rat(101719679) peptidase inhibitor 15
cow(532863) peptidase inhibitor 15
sheep(101109187) peptidase inhibitor 15
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_053191 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053191 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053191 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015886 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015886 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015886 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU055021 MISSION® esiRNA targeting human PI15 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015886 Rosetta Predictions human pricing
NM_001106917 Rosetta Predictions rat pricing
NM_053191 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015886 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00197977 predicted 317
2 SASI_Hs01_00197978 predicted 730
3 SASI_Hs01_00197979 predicted 297
4 SASI_Hs01_00197980 predicted 519
5 SASI_Hs01_00197981 predicted 289
6 SASI_Hs01_00197982 predicted 228
7 SASI_Hs01_00197983 predicted 922
8 SASI_Hs01_00197984 predicted 828
9 SASI_Hs01_00197985 predicted 604
10 SASI_Hs01_00197986 predicted 725
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106917 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00223676 predicted 331
2 SASI_Rn02_00223677 predicted 633
3 SASI_Rn02_00223678 predicted 490
4 SASI_Rn02_00223679 predicted 395
5 SASI_Rn02_00223680 predicted 635
6 SASI_Rn02_00223681 predicted 583
7 SASI_Rn02_00223682 predicted 258
8 SASI_Rn02_00223683 predicted 587
9 SASI_Rn02_00223684 predicted 600
10 SASI_Rn02_00223685 predicted 279
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053191 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00147682 predicted 426
2 SASI_Mm01_00147683 predicted 344
3 SASI_Mm01_00147684 predicted 512
4 SASI_Mm01_00147685 predicted 409
5 SASI_Mm01_00147686 predicted 223
6 SASI_Mm01_00147687 predicted 591
7 SASI_Mm02_00337761 predicted 511
8 SASI_Mm01_00147688 predicted 430
9 SASI_Mm01_00147689 predicted 512
10 SASI_Mm01_00147690 predicted 649
11 SASI_Mm01_00147691 predicted 625
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053191
VALIDATED
PI15 MISSION shRNA Bacterial Glycerol Stock
peptidase inhibitor 15
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000080373    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053191.1-1133s1c1
Sequence:CCGGCCACAGTTGTTGCATCCAATTCTCGAGAATTGGATGCAACAACTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053191.1-302s1c1
Sequence:CCGGGCCATTCTCGATTATCATAATCTCGAGATTATGATAATCGAGAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_053191.1-435s1c1
Sequence:CCGGGACCTTCTTATTTGCTGAGATCTCGAGATCTCAGCAAATAAGAAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053191.1-194s1c1
Sequence:CCGGCCAGCCAATAACTTCACTGATCTCGAGATCAGTGAAGTTATTGGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053191.1-633s1c1
Sequence:CCGGCCACTTCTAATCGAATAGGATCTCGAGATCCTATTCGATTAGAAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053191.2-316s21c1
Sequence:CCGGCCACTAGAGTCTGCGGATATCCTCGAGGATATCCGCAGACTCTAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377079    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053191.2-977s21c1
Sequence:CCGGCAATGGTTTCTGGACTAATAACTCGAGTTATTAGTCCAGAAACCATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348274    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053191.2-1360s21c1
Sequence:CCGGGATATGACACATAGGTAATAACTCGAGTTATTACCTATGTGTCATATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053191.2-382s21c1
Sequence:CCGGGCCATTCTCGATTATCATAATCTCGAGATTATGATAATCGAGAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053191.2-515s21c1
Sequence:CCGGGACCTTCTTATTTGCTGAGATCTCGAGATCTCAGCAAATAAGAAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053191.2-866s21c1
Sequence:CCGGCATCGTGTCCTCCAAGTTATGCTCGAGCATAACTTGGAGGACACGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053191.2-344s21c1
Sequence:CCGGCCAGGCGGAAGCGTTACATTTCTCGAGAAATGTAACGCTTCCGCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053191
VALIDATED
PI15 MISSION shRNA shRNA Plasmid DNA
peptidase inhibitor 15
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000080373    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053191.1-1133s1c1
Sequence:CCGGCCACAGTTGTTGCATCCAATTCTCGAGAATTGGATGCAACAACTGTGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000080377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053191.1-302s1c1
Sequence:CCGGGCCATTCTCGATTATCATAATCTCGAGATTATGATAATCGAGAATGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000080376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_053191.1-435s1c1
Sequence:CCGGGACCTTCTTATTTGCTGAGATCTCGAGATCTCAGCAAATAAGAAGGTCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000080374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053191.1-194s1c1
Sequence:CCGGCCAGCCAATAACTTCACTGATCTCGAGATCAGTGAAGTTATTGGCTGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000080375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053191.1-633s1c1
Sequence:CCGGCCACTTCTAATCGAATAGGATCTCGAGATCCTATTCGATTAGAAGTGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000377143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053191.2-316s21c1
Sequence:CCGGCCACTAGAGTCTGCGGATATCCTCGAGGATATCCGCAGACTCTAGTGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000377079    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053191.2-977s21c1
Sequence:CCGGCAATGGTTTCTGGACTAATAACTCGAGTTATTAGTCCAGAAACCATTGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000348274    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053191.2-1360s21c1
Sequence:CCGGGATATGACACATAGGTAATAACTCGAGTTATTACCTATGTGTCATATCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000334777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053191.2-382s21c1
Sequence:CCGGGCCATTCTCGATTATCATAATCTCGAGATTATGATAATCGAGAATGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000334859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053191.2-515s21c1
Sequence:CCGGGACCTTCTTATTTGCTGAGATCTCGAGATCTCAGCAAATAAGAAGGTCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000364018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053191.2-866s21c1
Sequence:CCGGCATCGTGTCCTCCAAGTTATGCTCGAGCATAACTTGGAGGACACGATGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000377077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053191.2-344s21c1
Sequence:CCGGCCAGGCGGAAGCGTTACATTTCTCGAGAAATGTAACGCTTCCGCCTGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053191
VALIDATED
PI15 MISSION shRNA Lentiviral Transduction Particles
peptidase inhibitor 15
Mouse
12 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000080373    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053191.1-1133s1c1
Sequence:CCGGCCACAGTTGTTGCATCCAATTCTCGAGAATTGGATGCAACAACTGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053191.1-302s1c1
Sequence:CCGGGCCATTCTCGATTATCATAATCTCGAGATTATGATAATCGAGAATGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_053191.1-435s1c1
Sequence:CCGGGACCTTCTTATTTGCTGAGATCTCGAGATCTCAGCAAATAAGAAGGTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053191.1-194s1c1
Sequence:CCGGCCAGCCAATAACTTCACTGATCTCGAGATCAGTGAAGTTATTGGCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053191.1-633s1c1
Sequence:CCGGCCACTTCTAATCGAATAGGATCTCGAGATCCTATTCGATTAGAAGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000377143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053191.2-316s21c1
Sequence:CCGGCCACTAGAGTCTGCGGATATCCTCGAGGATATCCGCAGACTCTAGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000377079    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053191.2-977s21c1
Sequence:CCGGCAATGGTTTCTGGACTAATAACTCGAGTTATTAGTCCAGAAACCATTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348274    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053191.2-1360s21c1
Sequence:CCGGGATATGACACATAGGTAATAACTCGAGTTATTACCTATGTGTCATATCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053191.2-382s21c1
Sequence:CCGGGCCATTCTCGATTATCATAATCTCGAGATTATGATAATCGAGAATGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334859    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053191.2-515s21c1
Sequence:CCGGGACCTTCTTATTTGCTGAGATCTCGAGATCTCAGCAAATAAGAAGGTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053191.2-866s21c1
Sequence:CCGGCATCGTGTCCTCCAAGTTATGCTCGAGCATAACTTGGAGGACACGATGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000377077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053191.2-344s21c1
Sequence:CCGGCCAGGCGGAAGCGTTACATTTCTCGAGAAATGTAACGCTTCCGCCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015886
PI15 MISSION shRNA Bacterial Glycerol Stock
peptidase inhibitor 15
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015886.1-867s1c1
Sequence:CCGGGCACTGGAAGATATCGCTCTACTCGAGTAGAGCGATATCTTCCAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161313    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015886.1-1041s1c1
Sequence:CCGGGCGCAATTCATACTTGCCAAACTCGAGTTTGGCAAGTATGAATTGCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015886.1-673s1c1
Sequence:CCGGGCAGAATGACATGATCGCCATCTCGAGATGGCGATCATGTCATTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015886.1-611s1c1
Sequence:CCGGGCTCTGAAAGCACAATTAGATCTCGAGATCTAATTGTGCTTTCAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160377    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015886.1-1200s1c1
Sequence:CCGGCTTGTACTGACAATCTGTGTTCTCGAGAACACAGATTGTCAGTACAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160723    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015886.1-960s1c1
Sequence:CCGGCCAGATGTCCTATGAGATGTTCTCGAGAACATCTCATAGGACATCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015886.1-620s1c1
Sequence:CCGGGCACAATTAGATTCAGCGGATCTCGAGATCCGCTGAATCTAATTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162056    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015886.1-1170s1c1
Sequence:CCGGGTTCATCTTGTCCTCCAAGTTCTCGAGAACTTGGAGGACAAGATGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166127    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015886.1-1020s1c1
Sequence:CCGGCCACTTCCAATCGGATAGGATCTCGAGATCCTATCCGATTGGAAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166695    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015886.1-1088s1c1
Sequence:CCGGCGACGTGCAGTTTACTTGGTACTCGAGTACCAAGTAAACTGCACGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015886
PI15 MISSION shRNA shRNA Plasmid DNA
peptidase inhibitor 15
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015886.1-867s1c1
Sequence:CCGGGCACTGGAAGATATCGCTCTACTCGAGTAGAGCGATATCTTCCAGTGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000161313    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015886.1-1041s1c1
Sequence:CCGGGCGCAATTCATACTTGCCAAACTCGAGTTTGGCAAGTATGAATTGCGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000165911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015886.1-673s1c1
Sequence:CCGGGCAGAATGACATGATCGCCATCTCGAGATGGCGATCATGTCATTCTGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000159251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015886.1-611s1c1
Sequence:CCGGGCTCTGAAAGCACAATTAGATCTCGAGATCTAATTGTGCTTTCAGAGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000160377    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015886.1-1200s1c1
Sequence:CCGGCTTGTACTGACAATCTGTGTTCTCGAGAACACAGATTGTCAGTACAAGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000160723    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015886.1-960s1c1
Sequence:CCGGCCAGATGTCCTATGAGATGTTCTCGAGAACATCTCATAGGACATCTGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000161559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015886.1-620s1c1
Sequence:CCGGGCACAATTAGATTCAGCGGATCTCGAGATCCGCTGAATCTAATTGTGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000162056    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015886.1-1170s1c1
Sequence:CCGGGTTCATCTTGTCCTCCAAGTTCTCGAGAACTTGGAGGACAAGATGAACTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000166127    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015886.1-1020s1c1
Sequence:CCGGCCACTTCCAATCGGATAGGATCTCGAGATCCTATCCGATTGGAAGTGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000166695    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015886.1-1088s1c1
Sequence:CCGGCGACGTGCAGTTTACTTGGTACTCGAGTACCAAGTAAACTGCACGTCGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015886
PI15 MISSION shRNA Lentiviral Transduction Particles
peptidase inhibitor 15
Human
10 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000166088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015886.1-867s1c1
Sequence:CCGGGCACTGGAAGATATCGCTCTACTCGAGTAGAGCGATATCTTCCAGTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161313    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015886.1-1041s1c1
Sequence:CCGGGCGCAATTCATACTTGCCAAACTCGAGTTTGGCAAGTATGAATTGCGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015886.1-673s1c1
Sequence:CCGGGCAGAATGACATGATCGCCATCTCGAGATGGCGATCATGTCATTCTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015886.1-611s1c1
Sequence:CCGGGCTCTGAAAGCACAATTAGATCTCGAGATCTAATTGTGCTTTCAGAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160377    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015886.1-1200s1c1
Sequence:CCGGCTTGTACTGACAATCTGTGTTCTCGAGAACACAGATTGTCAGTACAAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160723    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015886.1-960s1c1
Sequence:CCGGCCAGATGTCCTATGAGATGTTCTCGAGAACATCTCATAGGACATCTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015886.1-620s1c1
Sequence:CCGGGCACAATTAGATTCAGCGGATCTCGAGATCCGCTGAATCTAATTGTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162056    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015886.1-1170s1c1
Sequence:CCGGGTTCATCTTGTCCTCCAAGTTCTCGAGAACTTGGAGGACAAGATGAACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166127    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015886.1-1020s1c1
Sequence:CCGGCCACTTCCAATCGGATAGGATCTCGAGATCCTATCCGATTGGAAGTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166695    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015886.1-1088s1c1
Sequence:CCGGCGACGTGCAGTTTACTTGGTACTCGAGTACCAAGTAAACTGCACGTCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)