EMAIL THIS PAGE TO A FRIEND

PI16

peptidase inhibitor 16

62 Gene Product Result for
Synonyms: CRISP9 MSMBBP PSPBP
UniProtKB ID: Q6UXB8, Q6ZVG9, Q8IYL8, Q8NBK0, Q8TCB8
Gene ID:
Mouse(74116) peptidase inhibitor 16
Rat(294312) peptidase inhibitor 16
chicken(419818) peptidase inhibitor 16
domestic cat(101082151) peptidase inhibitor 16
dog(481769) peptidase inhibitor 16
cow(507058) peptidase inhibitor 16
sheep(101122471) peptidase inhibitor 16
naked mole-rat(101708997) peptidase inhibitor 16
domestic guinea pig(100723750) peptidase inhibitor 16
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153370 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153370 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153370 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023734 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023734 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023734 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153370 Rosetta Predictions human pricing
XM_001078697 Rosetta Predictions rat pricing
XM_215351 Rosetta Predictions rat pricing
NM_023734 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153370 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00046258 predicted 1531
2 SASI_Hs01_00046259 predicted 942
3 SASI_Hs02_00367250 predicted 1180
4 SASI_Hs01_00046260 predicted 1041
5 SASI_Hs01_00046261 predicted 911
6 SASI_Hs01_00046262 predicted 579
7 SASI_Hs01_00046263 predicted 1787
8 SASI_Hs01_00046264 predicted 793
9 SASI_Hs01_00046265 predicted 767
10 SASI_Hs01_00046266 predicted 707
11 SASI_Hs01_00046267 predicted 1517
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078697 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00361748 predicted 1235
2 SASI_Rn02_00361749 predicted 1286
3 SASI_Rn02_00361750 predicted 885
4 SASI_Rn02_00361751 predicted 813
5 SASI_Rn02_00361752 predicted 830
6 SASI_Rn02_00361753 predicted 1012
7 SASI_Rn02_00361754 predicted 1032
8 SASI_Rn02_00361755 predicted 1026
9 SASI_Rn02_00361756 predicted 609
10 SASI_Rn02_00361757 predicted 761
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_215351 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00375915 predicted 1285
2 SASI_Rn02_00375916 predicted 881
3 SASI_Rn02_00375917 predicted 815
4 SASI_Rn02_00375918 predicted 833
5 SASI_Rn02_00375919 predicted 1010
6 SASI_Rn02_00375920 predicted 1033
7 SASI_Rn02_00375921 predicted 1445
8 SASI_Rn02_00375922 predicted 1021
9 SASI_Rn02_00375923 predicted 608
10 SASI_Rn02_00375924 predicted 760
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023734 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00134231 predicted 1038
2 SASI_Mm02_00327313 predicted 1492
3 SASI_Mm01_00134232 predicted 1026
4 SASI_Mm02_00327314 predicted 1312
5 SASI_Mm01_00134233 predicted 792
6 SASI_Mm01_00134236 predicted 1098
7 SASI_Mm01_00134237 predicted 1246
8 SASI_Mm02_00327315 predicted 1537
9 SASI_Mm01_00134238 predicted 738
10 SASI_Mm01_00134239 predicted 1650
11 SASI_Mm01_00134230 predicted 309
12 SASI_Mm01_00134234 predicted 1946
13 SASI_Mm01_00134235 predicted 886
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153370
PI16 MISSION shRNA Bacterial Glycerol Stock
peptidase inhibitor 16
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000426680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153370.2-585s21c1
Sequence:CCGGGCGAGAATCTGTTCGCCATCACTCGAGTGATGGCGAACAGATTCTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204441    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153370.1-990s1c1
Sequence:CCGGCGACTGAAGCATCAGACTCTACTCGAGTAGAGTCTGATGCTTCAGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204768    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153370.1-1020s1c1
Sequence:CCGGGTACTCCTTCTTCCCTAGCAACTCGAGTTGCTAGGGAAGAAGGAGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153370.2-1534s21c1
Sequence:CCGGCAATACCTCTGCCACCGCTAACTCGAGTTAGCGGTGGCAGAGGTATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164783    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153370.1-1281s1c1
Sequence:CCGGCAGCAGACAAAGTGACAGACACTCGAGTGTCTGTCACTTTGTCTGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163937    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153370.1-788s1c1
Sequence:CCGGGAGGAGACCAACATCGAATTACTCGAGTAATTCGATGTTGGTCTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163767    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153370.1-995s1c1
Sequence:CCGGGAAGCATCAGACTCTAGGAAACTCGAGTTTCCTAGAGTCTGATGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163376    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153370.1-1283s1c1
Sequence:CCGGGCAGACAAAGTGACAGACAAACTCGAGTTTGTCTGTCACTTTGTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188401    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153370.1-993s1c1
Sequence:CCGGCTGAAGCATCAGACTCTAGGACTCGAGTCCTAGAGTCTGATGCTTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187256    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153370.1-1121s1c1
Sequence:CCGGCCAACTTCCTTAGCAACGAAACTCGAGTTTCGTTGCTAAGGAAGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153370
PI16 MISSION shRNA shRNA Plasmid DNA
peptidase inhibitor 16
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000426680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153370.2-585s21c1
Sequence:CCGGGCGAGAATCTGTTCGCCATCACTCGAGTGATGGCGAACAGATTCTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000204441    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153370.1-990s1c1
Sequence:CCGGCGACTGAAGCATCAGACTCTACTCGAGTAGAGTCTGATGCTTCAGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000204768    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153370.1-1020s1c1
Sequence:CCGGGTACTCCTTCTTCCCTAGCAACTCGAGTTGCTAGGGAAGAAGGAGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153370.2-1534s21c1
Sequence:CCGGCAATACCTCTGCCACCGCTAACTCGAGTTAGCGGTGGCAGAGGTATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164783    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153370.1-1281s1c1
Sequence:CCGGCAGCAGACAAAGTGACAGACACTCGAGTGTCTGTCACTTTGTCTGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163937    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153370.1-788s1c1
Sequence:CCGGGAGGAGACCAACATCGAATTACTCGAGTAATTCGATGTTGGTCTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163767    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153370.1-995s1c1
Sequence:CCGGGAAGCATCAGACTCTAGGAAACTCGAGTTTCCTAGAGTCTGATGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163376    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153370.1-1283s1c1
Sequence:CCGGGCAGACAAAGTGACAGACAAACTCGAGTTTGTCTGTCACTTTGTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188401    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153370.1-993s1c1
Sequence:CCGGCTGAAGCATCAGACTCTAGGACTCGAGTCCTAGAGTCTGATGCTTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187256    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153370.1-1121s1c1
Sequence:CCGGCCAACTTCCTTAGCAACGAAACTCGAGTTTCGTTGCTAAGGAAGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153370
PI16 MISSION shRNA Lentiviral Transduction Particles
peptidase inhibitor 16
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000426680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153370.2-585s21c1
Sequence:CCGGGCGAGAATCTGTTCGCCATCACTCGAGTGATGGCGAACAGATTCTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204441    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153370.1-990s1c1
Sequence:CCGGCGACTGAAGCATCAGACTCTACTCGAGTAGAGTCTGATGCTTCAGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204768    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153370.1-1020s1c1
Sequence:CCGGGTACTCCTTCTTCCCTAGCAACTCGAGTTGCTAGGGAAGAAGGAGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153370.2-1534s21c1
Sequence:CCGGCAATACCTCTGCCACCGCTAACTCGAGTTAGCGGTGGCAGAGGTATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164783    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153370.1-1281s1c1
Sequence:CCGGCAGCAGACAAAGTGACAGACACTCGAGTGTCTGTCACTTTGTCTGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163937    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153370.1-788s1c1
Sequence:CCGGGAGGAGACCAACATCGAATTACTCGAGTAATTCGATGTTGGTCTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163767    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153370.1-995s1c1
Sequence:CCGGGAAGCATCAGACTCTAGGAAACTCGAGTTTCCTAGAGTCTGATGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163376    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153370.1-1283s1c1
Sequence:CCGGGCAGACAAAGTGACAGACAAACTCGAGTTTGTCTGTCACTTTGTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188401    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153370.1-993s1c1
Sequence:CCGGCTGAAGCATCAGACTCTAGGACTCGAGTCCTAGAGTCTGATGCTTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187256    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153370.1-1121s1c1
Sequence:CCGGCCAACTTCCTTAGCAACGAAACTCGAGTTTCGTTGCTAAGGAAGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023734
PI16 MISSION shRNA Bacterial Glycerol Stock
peptidase inhibitor 16
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106430    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023734.2-1950s1c1
Sequence:CCGGCCCATGCAACTCTTCTGTCTTCTCGAGAAGACAGAAGAGTTGCATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023734.2-1388s1c1
Sequence:CCGGCCGACTGGGATTTGAAGAATTCTCGAGAATTCTTCAAATCCCAGTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023734.2-704s1c1
Sequence:CCGGAGACTCTACATTTCTCGGTAACTCGAGTTACCGAGAAATGTAGAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023734.2-931s1c1
Sequence:CCGGCCCAAATCTATGGACGAAGAACTCGAGTTCTTCGTCCATAGATTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023734.2-243s1c1
Sequence:CCGGCGGAGAGAACTTGTTTGCCATCTCGAGATGGCAAACAAGTTCTCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023734
PI16 MISSION shRNA shRNA Plasmid DNA
peptidase inhibitor 16
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106430    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023734.2-1950s1c1
Sequence:CCGGCCCATGCAACTCTTCTGTCTTCTCGAGAAGACAGAAGAGTTGCATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023734.2-1388s1c1
Sequence:CCGGCCGACTGGGATTTGAAGAATTCTCGAGAATTCTTCAAATCCCAGTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023734.2-704s1c1
Sequence:CCGGAGACTCTACATTTCTCGGTAACTCGAGTTACCGAGAAATGTAGAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023734.2-931s1c1
Sequence:CCGGCCCAAATCTATGGACGAAGAACTCGAGTTCTTCGTCCATAGATTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023734.2-243s1c1
Sequence:CCGGCGGAGAGAACTTGTTTGCCATCTCGAGATGGCAAACAAGTTCTCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023734
PI16 MISSION shRNA Lentiviral Transduction Particles
peptidase inhibitor 16
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106430    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023734.2-1950s1c1
Sequence:CCGGCCCATGCAACTCTTCTGTCTTCTCGAGAAGACAGAAGAGTTGCATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023734.2-1388s1c1
Sequence:CCGGCCGACTGGGATTTGAAGAATTCTCGAGAATTCTTCAAATCCCAGTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023734.2-704s1c1
Sequence:CCGGAGACTCTACATTTCTCGGTAACTCGAGTTACCGAGAAATGTAGAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023734.2-931s1c1
Sequence:CCGGCCCAAATCTATGGACGAAGAACTCGAGTTCTTCGTCCATAGATTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023734.2-243s1c1
Sequence:CCGGCGGAGAGAACTTGTTTGCCATCTCGAGATGGCAAACAAGTTCTCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)