EMAIL THIS PAGE TO A FRIEND

PI3

peptidase inhibitor 3, skin-derived

41 Gene Product Result for
Synonyms: ESI SKALP WAP3 WFDC14 cementoin
UniProtKB ID: P19957, E1P618, Q6FG74
Gene ID:
Human(5266) Summary: This gene encodes an elastase-specific inhibitor that functions as an antimicrobial peptide against Gram-positive and Gram-negative bacteria. The protein contains a WAP-type four-disulfide core (WFDC) domain, and is thus a member of the WFDC domain family. Most WFDC gene members are localized to chromosome 20q12-q13 in two clusters: centromeric and telomeric. This gene belongs to the centromeric cluster. Expression of this gene is upgulated by bacterial lipopolysaccharides and cytokines. [provided by RefSeq, Oct 2008]
cow(407165) peptidase inhibitor 3, skin-derived (SKALP)
cow(783871) peptidase inhibitor 3, skin-derived (SKALP)
domestic cat(101090932) peptidase inhibitor 3, skin-derived
dog(477241) peptidase inhibitor 3, skin-derived
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002638 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002638 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002638 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU145271 MISSION® esiRNA esiRNA human PI3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002638 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002638 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00334165 predicted 208
2 SASI_Hs01_00202097 predicted 244
3 SASI_Hs01_00202098 predicted 224
4 SASI_Hs01_00202099 predicted 197
5 SASI_Hs01_00202100 predicted 370
6 SASI_Hs01_00202101 predicted 193
7 SASI_Hs01_00202102 predicted 226
8 SASI_Hs02_00334166 predicted 219
9 SASI_Hs01_00202104 predicted 200
10 SASI_Hs01_00202105 predicted 238
11 SASI_Hs01_00202103 predicted 218
12 SASI_Hs01_00202106 predicted 209
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002638
PI3 MISSION shRNA Bacterial Glycerol Stock
peptidase inhibitor 3, skin-derived
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000373200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002638.3-64s21c1
Sequence:CCGGATCGCTGGGACGCTGGTTCTACTCGAGTAGAACCAGCGTCCCAGCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002638.2-348s1c1
Sequence:CCGGAGATACTGACTGCCCAGGAATCTCGAGATTCCTGGGCAGTCAGTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002638.2-178s1c1
Sequence:CCGGCGTGTTCCATTCAATGGACAACTCGAGTTGTCCATTGAATGGAACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002638.2-202s1c1
Sequence:CCGGCCCGTTAAAGGACAAGTTTCACTCGAGTGAAACTTGTCCTTTAACGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002638.2-232s1c1
Sequence:CCGGCAAGATAAAGTCAAAGCGCAACTCGAGTTGCGCTTTGACTTTATCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002638.2-199s1c1
Sequence:CCGGGATCCCGTTAAAGGACAAGTTCTCGAGAACTTGTCCTTTAACGGGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002638.3-94s21c1
Sequence:CCGGGTCACGGGAGTTCCTGTTAAACTCGAGTTTAACAGGAACTCCCGTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002638.3-111s21c1
Sequence:CCGGTAAAGGTCAAGACACTGTCAACTCGAGTTGACAGTGTCTTGACCTTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002638
PI3 MISSION shRNA shRNA Plasmid DNA
peptidase inhibitor 3, skin-derived
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000373200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002638.3-64s21c1
Sequence:CCGGATCGCTGGGACGCTGGTTCTACTCGAGTAGAACCAGCGTCCCAGCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002638.2-348s1c1
Sequence:CCGGAGATACTGACTGCCCAGGAATCTCGAGATTCCTGGGCAGTCAGTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002638.2-178s1c1
Sequence:CCGGCGTGTTCCATTCAATGGACAACTCGAGTTGTCCATTGAATGGAACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002638.2-202s1c1
Sequence:CCGGCCCGTTAAAGGACAAGTTTCACTCGAGTGAAACTTGTCCTTTAACGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002638.2-232s1c1
Sequence:CCGGCAAGATAAAGTCAAAGCGCAACTCGAGTTGCGCTTTGACTTTATCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002638.2-199s1c1
Sequence:CCGGGATCCCGTTAAAGGACAAGTTCTCGAGAACTTGTCCTTTAACGGGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002638.3-94s21c1
Sequence:CCGGGTCACGGGAGTTCCTGTTAAACTCGAGTTTAACAGGAACTCCCGTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002638.3-111s21c1
Sequence:CCGGTAAAGGTCAAGACACTGTCAACTCGAGTTGACAGTGTCTTGACCTTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002638
PI3 MISSION shRNA Lentiviral Transduction Particles
peptidase inhibitor 3, skin-derived
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000373200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002638.3-64s21c1
Sequence:CCGGATCGCTGGGACGCTGGTTCTACTCGAGTAGAACCAGCGTCCCAGCGATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000073666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002638.2-348s1c1
Sequence:CCGGAGATACTGACTGCCCAGGAATCTCGAGATTCCTGGGCAGTCAGTATCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000073663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002638.2-178s1c1
Sequence:CCGGCGTGTTCCATTCAATGGACAACTCGAGTTGTCCATTGAATGGAACACGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000073665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002638.2-202s1c1
Sequence:CCGGCCCGTTAAAGGACAAGTTTCACTCGAGTGAAACTTGTCCTTTAACGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000073664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002638.2-232s1c1
Sequence:CCGGCAAGATAAAGTCAAAGCGCAACTCGAGTTGCGCTTTGACTTTATCTTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000073667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002638.2-199s1c1
Sequence:CCGGGATCCCGTTAAAGGACAAGTTCTCGAGAACTTGTCCTTTAACGGGATCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000373198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002638.3-94s21c1
Sequence:CCGGGTCACGGGAGTTCCTGTTAAACTCGAGTTTAACAGGAACTCCCGTGACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000373199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002638.3-111s21c1
Sequence:CCGGTAAAGGTCAAGACACTGTCAACTCGAGTTGACAGTGTCTTGACCTTTATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???