PI4K2B

phosphatidylinositol 4-kinase type 2 beta

167 Gene Product Result for

Synonyms: PI4KIIB PIK42B

Species: Human PI4K2B(55300), Mouse Pi4k2b(67073), Rat Pi4k2b(305419), Zebrafish pi4k2b(564750), chicken PI4K2B(422807), domestic cat PI4K2B(101080788), dog PI4K2B(100682913), cow PI4K2B(521790), sheep PI4K2B(101105250), Domestic Rabbit PI4K2B(100345479), naked mole-rat Pi4k2b(101700160), domestic guinea pig Pi4k2b(100717919)

UniProtKB ID: Q8TCG2, Q9NUW2

Gene ID:

Human(55300) Summary: Phosphatidylinositol 4-kinases (PI4Ks) phosphorylate phosphatidylinositol to generate phosphatidylinositol 4-phosphate (PIP), an immediate precursor of several important signaling and scaffolding molecules. PIP itself may also have direct functional and structural roles. PI4K2B is a primarily cytosolic PI4K that is recruited to membranes, where it stimulates phosphatidylinositol 4,5-bisphosphate synthesis (Wei et al., 2002 [PubMed 12324459]

Mouse(67073) phosphatidylinositol 4-kinase type 2 beta

Rat(305419) phosphatidylinositol 4-kinase type 2 beta

Zebrafish(564750) phosphatidylinositol 4-kinase type 2 beta

chicken(422807) phosphatidylinositol 4-kinase type 2 beta

domestic cat(101080788) phosphatidylinositol 4-kinase type 2 beta

dog(100682913) phosphatidylinositol 4-kinase type 2 beta

cow(521790) phosphatidylinositol 4-kinase type 2 beta

sheep(101105250) phosphatidylinositol 4-kinase type 2 beta

Domestic Rabbit(100345479) phosphatidylinositol 4-kinase type 2 beta

naked mole-rat(101700160) phosphatidylinositol 4-kinase type 2 beta

domestic guinea pig(100717919) phosphatidylinositol 4-kinase type 2 beta

Custom Gene Products

Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product #	Description	Species Reactivity	Application	Add to Cart

SAB2107254	Anti-PI4K2B antibody produced in rabbit affinity isolated antibody	horse, yeast, mouse, rat, dog, guinea pig, rabbit, human	western blot	pricing

SAB2106070	Anti-PI4K2B antibody produced in rabbit affinity isolated antibody	rabbit, human, horse, mouse, rat, guinea pig	western blot	pricing

HPA004099	Anti-PI4K2B antibody produced in rabbit Prestige Antibodies^® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution	human	immunofluorescence, immunohistochemistry, western blot	pricing

SAB2700974	Anti-PI4K2B antibody produced in rabbit affinity isolated antibody, buffered aqueous solution	human	western blot	pricing

Proteins

Product #	Description	Species	Add to Cart

SRP5064	PI4K2B, active, GST tagged human PRECISIO^® Kinase, recombinant, expressed in baculovirus infected Sf9 cells, ≥70% (SDS-PAGE), buffered aqueous glycerol solution	human	pricing

QPREST32569	SILu^™PrEST P4K2B SILuPrESTs Powered by Atlas Antibodies, buffered aqueous solution	human	pricing

3'UTR GoClone

Product #	Description	Species	Add to Cart

HUTR10610	MISSION^® 3′UTR Lenti GoClone^™ Powered by SwitchGear Genomics^™, 3′UTR, human, PI4K2B	human	pricing

shRNA

Type	Description	Species	Add to Cart

SHCLNG-NM_018323	MISSION® shRNA Bacterial Glycerol Stock	human	pricing
SHCLND-NM_018323	MISSION® shRNA Plasmid DNA	human	pricing
SHCLNV-NM_018323	MISSION® shRNA Lentiviral Transduction Particles	human	pricing
SHCLNG-NM_025951	MISSION® shRNA Bacterial Glycerol Stock	mouse	pricing
SHCLND-NM_025951	MISSION® shRNA Plasmid DNA	mouse	pricing
SHCLNV-NM_025951	MISSION® shRNA Lentiviral Transduction Particles	mouse	pricing

esiRNA

Product #	Description	Species	Add to Cart

EHU016031	MISSION^® esiRNA targeting human PI4K2B, RP11-717K11.2	human	pricing

EMU004121	MISSION^® esiRNA targeting mouse Pi4k2b	mouse	pricing

SYBR® Green Primers

Product #	Description

KSPQ12012	KiCqStart® SYBR® Green Primers Predesigned primers for gene expression analysis
KSGA2013	KiCqStart® SYBR® Green Primers Gene Arrays for expression analysis of gene families

Custom CRISPR Plasmid

Product #	Description

CRISPR	Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.

Product #	siRNA Type	Species

NM_018323	Rosetta Predictions	human	pricing
NM_001005883	Rosetta Predictions	rat	pricing
NM_025951	Rosetta Predictions	mouse	pricing
NM_028744	Rosetta Predictions	mouse	pricing

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_018323	Rosetta Predictions	Human

Ranking	siRNA ID	Sequence Start ?
1	SASI_Hs01_00212532 predicted	1419
2	SASI_Hs01_00212533 predicted	565
3	SASI_Hs02_00351756 predicted	449
4	SASI_Hs01_00212537 predicted	830
5	SASI_Hs01_00212538 predicted	416
6	SASI_Hs02_00351757 predicted	1104
7	SASI_Hs02_00351758 predicted	1265
8	SASI_Hs01_00212539 predicted	547
9	SASI_Hs02_00351759 predicted	1559
10	SASI_Hs01_00212540 predicted	487
11	SASI_Hs01_00212531 predicted	981
12	SASI_Hs01_00212534 predicted	1178
13	SASI_Hs01_00212535 predicted	1587
14	SASI_Hs01_00212536 predicted	1627

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_001005883	Rosetta Predictions	Rat

Ranking	siRNA ID	Sequence Start ?
1	SASI_Rn01_00084343 predicted	1106
2	SASI_Rn01_00084345 predicted	1039
3	SASI_Rn01_00084346 predicted	768
4	SASI_Rn01_00084348 predicted	531
5	SASI_Rn02_00198456 predicted	1187
6	SASI_Rn01_00084349 predicted	841
7	SASI_Rn02_00198457 predicted	1300
8	SASI_Rn01_00084350 predicted	1054
9	SASI_Rn01_00084351 predicted	378
10	SASI_Rn01_00084352 predicted	972
11	SASI_Rn01_00084344 predicted	932
12	SASI_Rn01_00084347 predicted	1107

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_025951	Rosetta Predictions	Mouse

Ranking	siRNA ID	Sequence Start ?
1	SASI_Mm02_00329346 predicted	1641
2	SASI_Mm02_00329347 predicted	1097
3	SASI_Mm02_00329348 predicted	1255
4	SASI_Mm02_00329349 predicted	1085
5	SASI_Mm02_00329350 predicted	1559
6	SASI_Mm01_00171620 predicted	1368
7	SASI_Mm02_00329351 predicted	1248
8	SASI_Mm01_00171622 predicted	1361
9	SASI_Mm02_00329352 predicted	1166
10	SASI_Mm02_00329353 predicted	1089
11	SASI_Mm01_00171619 predicted	1256
12	SASI_Mm01_00171621 predicted	1338
13	SASI_Mm01_00171623 predicted	1260
14	SASI_Mm01_00171624 predicted	1327
15	SASI_Mm01_00171625 predicted	1357
16	SASI_Mm01_00171626 predicted	1289
17	SASI_Mm01_00171627 predicted	1336
18	SASI_Mm01_00171628 predicted	1258

siRNA

PRODUCT #	siRNA Type ?	SPECIES
NM_028744	Rosetta Predictions	Mouse

Ranking	siRNA ID	Sequence Start ?
1	SASI_Mm02_00334318 predicted	1580
2	SASI_Mm02_00334319 predicted	1026
3	SASI_Mm02_00334320 predicted	1182
4	SASI_Mm02_00334321 predicted	1015
5	SASI_Mm02_00334322 predicted	1492
6	SASI_Mm01_00112445 predicted	1290
7	SASI_Mm02_00334323 predicted	1175
8	SASI_Mm01_00112447 predicted	1291
9	SASI_Mm02_00334324 predicted	1098
10	SASI_Mm02_00334325 predicted	1019
11	SASI_Mm01_00112444 predicted	1183
12	SASI_Mm01_00112446 predicted	1267
13	SASI_Mm01_00112448 predicted	1192
14	SASI_Mm01_00112449 predicted	1263
15	SASI_Mm01_00112450 predicted	1286
16	SASI_Mm01_00112451 predicted	1223
17	SASI_Mm01_00112452 predicted	1272
18	SASI_Mm01_00112453 predicted	1181

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNG-NM_018323 VALIDATED	PI4K2B MISSION shRNA Bacterial Glycerol Stock phosphatidylinositol 4-kinase type 2 beta	Human

19 Products Total

TRC Number			Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000194791
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.56	Cell Line: A3
	TRC Version: 1	Clone ID:NM_018323.2-1029s1c1
	Sequence:CCGGCAATGATAATTGGTTAGTCAGCTCGAGCTGACTAACCAATTATCATTGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000037587
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.93	Cell Line: A549
	TRC Version: 1	Clone ID:NM_018323.2-1132s1c1
	Sequence:CCGGGCTGCAATTGATAATGGTCTACTCGAGTAGACCATTATCAATTGCAGCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000037588
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.96	Cell Line: A549
	TRC Version: 1	Clone ID:NM_018323.2-1273s1c1
	Sequence:CCGGGACATGAACTTTGTGCAAGATCTCGAGATCTTGCACAAAGTTCATGTCTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000037585
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.77	Cell Line: A549
	TRC Version: 1	Clone ID:NM_018323.2-858s1c1
	Sequence:CCGGCCCTCCTAAGATTGGTTCCTTCTCGAGAAGGAACCAATCTTAGGAGGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000037586
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.85	Cell Line: A549
	TRC Version: 1	Clone ID:NM_018323.2-1423s1c1
	Sequence:CCGGCCTTTCCAGCTAGTACAGATACTCGAGTATCTGTACTAGCTGGAAAGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000037584
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.92	Cell Line: A549
	TRC Version: 1	Clone ID:NM_018323.2-420s1c1
	Sequence:CCGGCCCAGAATTTGCTGATATTATCTCGAGATAATATCAGCAAATTCTGGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000196628
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.72	Cell Line: A549
	TRC Version: 1	Clone ID:NM_018323.2-1287s1c1
	Sequence:CCGGGCAAGATTTATGTGAAGATCTCTCGAGAGATCTTCACATAAATCTTGCTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000229846
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.82	Cell Line: A549
	TRC Version: 2	Clone ID:NM_018323.2-419s21c1
	Sequence:CCGGACCCAGAATTTGCTGATATTACTCGAGTAATATCAGCAAATTCTGGGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000229847
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.55	Cell Line: A549
	TRC Version: 2	Clone ID:NM_018323.2-2059s21c1
	Sequence:CCGGACTCCTAAAGTGACCATTATTCTCGAGAATAATGGTCACTTTAGGAGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000194997
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.88	Cell Line: A549
	TRC Version: 1	Clone ID:NM_018323.2-709s1c1
	Sequence:CCGGCATCTGAGCATTGTACCTAAACTCGAGTTTAGGTACAATGCTCAGATGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000195310
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.87	Cell Line: A549
	TRC Version: 1	Clone ID:NM_018323.2-493s1c1
	Sequence:CCGGCAAGGTTCAAGTGGAAGTTACCTCGAGGTAACTTCCACTTGAACCTTGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000195443
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.96	Cell Line: A549
	TRC Version: 1	Clone ID:NM_018323.2-1171s1c1
	Sequence:CCGGCCTGATGAATGGAGAGCATATCTCGAGATATGCTCTCCATTCATCAGGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000195735
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.71	Cell Line: A549
	TRC Version: 1	Clone ID:NM_018323.2-377s1c1
	Sequence:CCGGCAGTAACTATTGGTACTTCAGCTCGAGCTGAAGTACCAATAGTTACTGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000196488
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.91	Cell Line: A549
	TRC Version: 1	Clone ID:NM_018323.2-1887s1c1
	Sequence:CCGGGAGAAGAATGTTCATGCTAATCTCGAGATTAGCATGAACATTCTTCTCTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000196629
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.9	Cell Line: A549
	TRC Version: 1	Clone ID:NM_018323.2-2349s1c1
	Sequence:CCGGGTACTGGCCTTGTTCAATTTACTCGAGTAAATTGAACAAGGCCAGTACTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000196739
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.91	Cell Line: A549
	TRC Version: 1	Clone ID:NM_018323.2-867s1c1
	Sequence:CCGGGATTGGTTCCTTTCAGTTATTCTCGAGAATAACTGAAAGGAACCAATCTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000217963
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.84	Cell Line: A549
	TRC Version: 2	Clone ID:NM_018323.2-1177s21c1
	Sequence:GTACCGGGAATGGAGAGCATATCCATTTCTCGAGAAATGGATATGCTCTCCATTCTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000218617
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_018323.2-594s21c1
	Sequence:GTACCGGATGGACCAAATATGTCCATAACTCGAGTTATGGACATATTTGGTCCATTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000229845
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.59	Cell Line: A549
	TRC Version: 2	Clone ID:NM_018323.2-368s21c1
	Sequence:CCGGCCGCGGTTTCAGTAACTATTGCTCGAGCAATAGTTACTGAAACCGCGGTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLND-NM_018323 VALIDATED	PI4K2B MISSION shRNA shRNA Plasmid DNA phosphatidylinositol 4-kinase type 2 beta	Human

19 Products Total

TRC Number		Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000194791
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.56	Cell Line: A3
	TRC Version: 1	Clone ID:NM_018323.2-1029s1c1
	Sequence:CCGGCAATGATAATTGGTTAGTCAGCTCGAGCTGACTAACCAATTATCATTGTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000037587
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.93	Cell Line: A549
	TRC Version: 1	Clone ID:NM_018323.2-1132s1c1
	Sequence:CCGGGCTGCAATTGATAATGGTCTACTCGAGTAGACCATTATCAATTGCAGCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000037588
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.96	Cell Line: A549
	TRC Version: 1	Clone ID:NM_018323.2-1273s1c1
	Sequence:CCGGGACATGAACTTTGTGCAAGATCTCGAGATCTTGCACAAAGTTCATGTCTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000037585
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.77	Cell Line: A549
	TRC Version: 1	Clone ID:NM_018323.2-858s1c1
	Sequence:CCGGCCCTCCTAAGATTGGTTCCTTCTCGAGAAGGAACCAATCTTAGGAGGGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000037586
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.85	Cell Line: A549
	TRC Version: 1	Clone ID:NM_018323.2-1423s1c1
	Sequence:CCGGCCTTTCCAGCTAGTACAGATACTCGAGTATCTGTACTAGCTGGAAAGGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000037584
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.92	Cell Line: A549
	TRC Version: 1	Clone ID:NM_018323.2-420s1c1
	Sequence:CCGGCCCAGAATTTGCTGATATTATCTCGAGATAATATCAGCAAATTCTGGGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000196628
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.72	Cell Line: A549
	TRC Version: 1	Clone ID:NM_018323.2-1287s1c1
	Sequence:CCGGGCAAGATTTATGTGAAGATCTCTCGAGAGATCTTCACATAAATCTTGCTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000229846
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.82	Cell Line: A549
	TRC Version: 2	Clone ID:NM_018323.2-419s21c1
	Sequence:CCGGACCCAGAATTTGCTGATATTACTCGAGTAATATCAGCAAATTCTGGGTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000229847
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.55	Cell Line: A549
	TRC Version: 2	Clone ID:NM_018323.2-2059s21c1
	Sequence:CCGGACTCCTAAAGTGACCATTATTCTCGAGAATAATGGTCACTTTAGGAGTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000194997
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.88	Cell Line: A549
	TRC Version: 1	Clone ID:NM_018323.2-709s1c1
	Sequence:CCGGCATCTGAGCATTGTACCTAAACTCGAGTTTAGGTACAATGCTCAGATGTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000195310
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.87	Cell Line: A549
	TRC Version: 1	Clone ID:NM_018323.2-493s1c1
	Sequence:CCGGCAAGGTTCAAGTGGAAGTTACCTCGAGGTAACTTCCACTTGAACCTTGTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000195443
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.96	Cell Line: A549
	TRC Version: 1	Clone ID:NM_018323.2-1171s1c1
	Sequence:CCGGCCTGATGAATGGAGAGCATATCTCGAGATATGCTCTCCATTCATCAGGTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000195735
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.71	Cell Line: A549
	TRC Version: 1	Clone ID:NM_018323.2-377s1c1
	Sequence:CCGGCAGTAACTATTGGTACTTCAGCTCGAGCTGAAGTACCAATAGTTACTGTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000196488
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.91	Cell Line: A549
	TRC Version: 1	Clone ID:NM_018323.2-1887s1c1
	Sequence:CCGGGAGAAGAATGTTCATGCTAATCTCGAGATTAGCATGAACATTCTTCTCTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000196629
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.9	Cell Line: A549
	TRC Version: 1	Clone ID:NM_018323.2-2349s1c1
	Sequence:CCGGGTACTGGCCTTGTTCAATTTACTCGAGTAAATTGAACAAGGCCAGTACTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000196739
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.91	Cell Line: A549
	TRC Version: 1	Clone ID:NM_018323.2-867s1c1
	Sequence:CCGGGATTGGTTCCTTTCAGTTATTCTCGAGAATAACTGAAAGGAACCAATCTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000217963
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.84	Cell Line: A549
	TRC Version: 2	Clone ID:NM_018323.2-1177s21c1
	Sequence:GTACCGGGAATGGAGAGCATATCCATTTCTCGAGAAATGGATATGCTCTCCATTCTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000218617
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_018323.2-594s21c1
	Sequence:GTACCGGATGGACCAAATATGTCCATAACTCGAGTTATGGACATATTTGGTCCATTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000229845
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.59	Cell Line: A549
	TRC Version: 2	Clone ID:NM_018323.2-368s21c1
	Sequence:CCGGCCGCGGTTTCAGTAACTATTGCTCGAGCAATAGTTACTGAAACCGCGGTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNV-NM_018323 VALIDATED	PI4K2B MISSION shRNA Lentiviral Transduction Particles phosphatidylinositol 4-kinase type 2 beta	Human

19 Products Total

TRC Number	Volume	Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000194791
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.56	Cell Line: A3
	TRC Version: 1	Clone ID:NM_018323.2-1029s1c1
	Sequence:CCGGCAATGATAATTGGTTAGTCAGCTCGAGCTGACTAACCAATTATCATTGTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000037587
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.93	Cell Line: A549
	TRC Version: 1	Clone ID:NM_018323.2-1132s1c1
	Sequence:CCGGGCTGCAATTGATAATGGTCTACTCGAGTAGACCATTATCAATTGCAGCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000037588
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.96	Cell Line: A549
	TRC Version: 1	Clone ID:NM_018323.2-1273s1c1
	Sequence:CCGGGACATGAACTTTGTGCAAGATCTCGAGATCTTGCACAAAGTTCATGTCTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000037585
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.77	Cell Line: A549
	TRC Version: 1	Clone ID:NM_018323.2-858s1c1
	Sequence:CCGGCCCTCCTAAGATTGGTTCCTTCTCGAGAAGGAACCAATCTTAGGAGGGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000037586
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.85	Cell Line: A549
	TRC Version: 1	Clone ID:NM_018323.2-1423s1c1
	Sequence:CCGGCCTTTCCAGCTAGTACAGATACTCGAGTATCTGTACTAGCTGGAAAGGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000037584
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.92	Cell Line: A549
	TRC Version: 1	Clone ID:NM_018323.2-420s1c1
	Sequence:CCGGCCCAGAATTTGCTGATATTATCTCGAGATAATATCAGCAAATTCTGGGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000196628
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.72	Cell Line: A549
	TRC Version: 1	Clone ID:NM_018323.2-1287s1c1
	Sequence:CCGGGCAAGATTTATGTGAAGATCTCTCGAGAGATCTTCACATAAATCTTGCTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000229846
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.82	Cell Line: A549
	TRC Version: 2	Clone ID:NM_018323.2-419s21c1
	Sequence:CCGGACCCAGAATTTGCTGATATTACTCGAGTAATATCAGCAAATTCTGGGTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000229847
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.55	Cell Line: A549
	TRC Version: 2	Clone ID:NM_018323.2-2059s21c1
	Sequence:CCGGACTCCTAAAGTGACCATTATTCTCGAGAATAATGGTCACTTTAGGAGTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000194997
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.88	Cell Line: A549
	TRC Version: 1	Clone ID:NM_018323.2-709s1c1
	Sequence:CCGGCATCTGAGCATTGTACCTAAACTCGAGTTTAGGTACAATGCTCAGATGTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000195310
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.87	Cell Line: A549
	TRC Version: 1	Clone ID:NM_018323.2-493s1c1
	Sequence:CCGGCAAGGTTCAAGTGGAAGTTACCTCGAGGTAACTTCCACTTGAACCTTGTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000195443
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.96	Cell Line: A549
	TRC Version: 1	Clone ID:NM_018323.2-1171s1c1
	Sequence:CCGGCCTGATGAATGGAGAGCATATCTCGAGATATGCTCTCCATTCATCAGGTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000195735
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.71	Cell Line: A549
	TRC Version: 1	Clone ID:NM_018323.2-377s1c1
	Sequence:CCGGCAGTAACTATTGGTACTTCAGCTCGAGCTGAAGTACCAATAGTTACTGTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000196488
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.91	Cell Line: A549
	TRC Version: 1	Clone ID:NM_018323.2-1887s1c1
	Sequence:CCGGGAGAAGAATGTTCATGCTAATCTCGAGATTAGCATGAACATTCTTCTCTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000196629
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.9	Cell Line: A549
	TRC Version: 1	Clone ID:NM_018323.2-2349s1c1
	Sequence:CCGGGTACTGGCCTTGTTCAATTTACTCGAGTAAATTGAACAAGGCCAGTACTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000196739
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.91	Cell Line: A549
	TRC Version: 1	Clone ID:NM_018323.2-867s1c1
	Sequence:CCGGGATTGGTTCCTTTCAGTTATTCTCGAGAATAACTGAAAGGAACCAATCTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000217963
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.84	Cell Line: A549
	TRC Version: 2	Clone ID:NM_018323.2-1177s21c1
	Sequence:GTACCGGGAATGGAGAGCATATCCATTTCTCGAGAAATGGATATGCTCTCCATTCTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000218617
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_018323.2-594s21c1
	Sequence:GTACCGGATGGACCAAATATGTCCATAACTCGAGTTATGGACATATTTGGTCCATTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000229845
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.59	Cell Line: A549
	TRC Version: 2	Clone ID:NM_018323.2-368s21c1
	Sequence:CCGGCCGCGGTTTCAGTAACTATTGCTCGAGCAATAGTTACTGAAACCGCGGTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNG-NM_025951 VALIDATED	PI4K2B MISSION shRNA Bacterial Glycerol Stock phosphatidylinositol 4-kinase type 2 beta	Mouse

8 Products Total

TRC Number			Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000024866
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.74	Cell Line: B16-F0
	TRC Version: 1	Clone ID:NM_025951.1-350s1c1
	Sequence:CCGGCGAGCTCAGAAACAAATACATCTCGAGATGTATTTGTTTCTGAGCTCGTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000024868
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.93	Cell Line: B16-F0
	TRC Version: 1	Clone ID:NM_025951.1-1048s1c1
	Sequence:CCGGGAGGAATCAAACTGGATTGATCTCGAGATCAATCCAGTTTGATTCCTCTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000024864
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.56	Cell Line: B16-F0
	TRC Version: 1	Clone ID:NM_025951.1-1132s1c1
	Sequence:CCGGCCTGATGAATGGCGAGCATATCTCGAGATATGCTCGCCATTCATCAGGTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000024867
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.69	Cell Line: B16-F0
	TRC Version: 1	Clone ID:NM_025951.1-555s1c1
	Sequence:CCGGGTGGACCAAGTACGTCCATAACTCGAGTTATGGACGTACTTGGTCCACTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000024865
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.98	Cell Line: B16-F0
	TRC Version: 1	Clone ID:NM_025951.1-843s1c1
	Sequence:CCGGGCTGTTTGTGAAAGATTACAACTCGAGTTGTAATCTTTCACAAACAGCTTTTT
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000361831
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.74	Cell Line: B16-F0
	TRC Version: 2	Clone ID:NM_025951.2-2016s21c1
	Sequence:CCGGAGAGCGGACAGTGATAGTAAACTCGAGTTTACTATCACTGTCCGCTCTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000361772
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.88	Cell Line: B16-F0
	TRC Version: 2	Clone ID:NM_025951.2-1248s21c1
	Sequence:CCGGACTTGATTCTACCCTATATTTCTCGAGAAATATAGGGTAGAATCAAGTTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000361773
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_025951.2-1029s21c1
	Sequence:CCGGATGATAACTGGCTAGTCAAATCTCGAGATTTGACTAGCCAGTTATCATTTTTTG
	Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLND-NM_025951 VALIDATED	PI4K2B MISSION shRNA shRNA Plasmid DNA phosphatidylinositol 4-kinase type 2 beta	Mouse

8 Products Total

TRC Number		Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000024866
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.74	Cell Line: B16-F0
	TRC Version: 1	Clone ID:NM_025951.1-350s1c1
	Sequence:CCGGCGAGCTCAGAAACAAATACATCTCGAGATGTATTTGTTTCTGAGCTCGTTTTT
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000024868
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.93	Cell Line: B16-F0
	TRC Version: 1	Clone ID:NM_025951.1-1048s1c1
	Sequence:CCGGGAGGAATCAAACTGGATTGATCTCGAGATCAATCCAGTTTGATTCCTCTTTTT
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000024864
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.56	Cell Line: B16-F0
	TRC Version: 1	Clone ID:NM_025951.1-1132s1c1
	Sequence:CCGGCCTGATGAATGGCGAGCATATCTCGAGATATGCTCGCCATTCATCAGGTTTTT
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000024867
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.69	Cell Line: B16-F0
	TRC Version: 1	Clone ID:NM_025951.1-555s1c1
	Sequence:CCGGGTGGACCAAGTACGTCCATAACTCGAGTTATGGACGTACTTGGTCCACTTTTT
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000024865
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.98	Cell Line: B16-F0
	TRC Version: 1	Clone ID:NM_025951.1-843s1c1
	Sequence:CCGGGCTGTTTGTGAAAGATTACAACTCGAGTTGTAATCTTTCACAAACAGCTTTTT
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000361831
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.74	Cell Line: B16-F0
	TRC Version: 2	Clone ID:NM_025951.2-2016s21c1
	Sequence:CCGGAGAGCGGACAGTGATAGTAAACTCGAGTTTACTATCACTGTCCGCTCTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000361772
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.88	Cell Line: B16-F0
	TRC Version: 2	Clone ID:NM_025951.2-1248s21c1
	Sequence:CCGGACTTGATTCTACCCTATATTTCTCGAGAAATATAGGGTAGAATCAAGTTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
We do not support the configuration options you have chosen
TRCN0000361773
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_025951.2-1029s21c1
	Sequence:CCGGATGATAACTGGCTAGTCAAATCTCGAGATTTGACTAGCCAGTTATCATTTTTTG
	Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery

Add to Cart

shRNA

PRODUCT TYPE	PRODUCT NAME	SPECIES
SHCLNV-NM_025951 VALIDATED	PI4K2B MISSION shRNA Lentiviral Transduction Particles phosphatidylinositol 4-kinase type 2 beta	Mouse

8 Products Total

TRC Number	Volume	Vector	Set Price (5+)?
We do not support the configuration options you have chosen
TRCN0000024866
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.74	Cell Line: B16-F0
	TRC Version: 1	Clone ID:NM_025951.1-350s1c1
	Sequence:CCGGCGAGCTCAGAAACAAATACATCTCGAGATGTATTTGTTTCTGAGCTCGTTTTT
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000024868
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.93	Cell Line: B16-F0
	TRC Version: 1	Clone ID:NM_025951.1-1048s1c1
	Sequence:CCGGGAGGAATCAAACTGGATTGATCTCGAGATCAATCCAGTTTGATTCCTCTTTTT
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000024864
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.56	Cell Line: B16-F0
	TRC Version: 1	Clone ID:NM_025951.1-1132s1c1
	Sequence:CCGGCCTGATGAATGGCGAGCATATCTCGAGATATGCTCGCCATTCATCAGGTTTTT
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000024867
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.69	Cell Line: B16-F0
	TRC Version: 1	Clone ID:NM_025951.1-555s1c1
	Sequence:CCGGGTGGACCAAGTACGTCCATAACTCGAGTTATGGACGTACTTGGTCCACTTTTT
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000024865
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.98	Cell Line: B16-F0
	TRC Version: 1	Clone ID:NM_025951.1-843s1c1
	Sequence:CCGGGCTGTTTGTGAAAGATTACAACTCGAGTTGTAATCTTTCACAAACAGCTTTTT
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000361831
Product Details Validated	Region:3UTR	Mean KnockDown Level: 0.74	Cell Line: B16-F0
	TRC Version: 2	Clone ID:NM_025951.2-2016s21c1
	Sequence:CCGGAGAGCGGACAGTGATAGTAAACTCGAGTTTACTATCACTGTCCGCTCTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000361772
Product Details Validated	Region:CDS	Mean KnockDown Level: 0.88	Cell Line: B16-F0
	TRC Version: 2	Clone ID:NM_025951.2-1248s21c1
	Sequence:CCGGACTTGATTCTACCCTATATTTCTCGAGAAATATAGGGTAGAATCAAGTTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
We do not support the configuration options you have chosen
TRCN0000361773
Product Details	Region:CDS
	TRC Version: 2	Clone ID:NM_025951.2-1029s21c1
	Sequence:CCGGATGATAACTGGCTAGTCAAATCTCGAGATTTGACTAGCCAGTTATCATTTTTTG
	Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)

Add to Cart