EMAIL THIS PAGE TO A FRIEND

PI4K2B

phosphatidylinositol 4-kinase type 2 beta

167 Gene Product Result for
Synonyms: PI4KIIB PIK42B
UniProtKB ID: Q8TCG2, Q9NUW2
Gene ID:
Human(55300) Summary: Phosphatidylinositol 4-kinases (PI4Ks) phosphorylate phosphatidylinositol to generate phosphatidylinositol 4-phosphate (PIP), an immediate precursor of several important signaling and scaffolding molecules. PIP itself may also have direct functional and structural roles. PI4K2B is a primarily cytosolic PI4K that is recruited to membranes, where it stimulates phosphatidylinositol 4,5-bisphosphate synthesis (Wei et al., 2002 [PubMed 12324459]
Mouse(67073) phosphatidylinositol 4-kinase type 2 beta
Rat(305419) phosphatidylinositol 4-kinase type 2 beta
Zebrafish(564750) phosphatidylinositol 4-kinase type 2 beta
chicken(422807) phosphatidylinositol 4-kinase type 2 beta
domestic cat(101080788) phosphatidylinositol 4-kinase type 2 beta
dog(100682913) phosphatidylinositol 4-kinase type 2 beta
cow(521790) phosphatidylinositol 4-kinase type 2 beta
sheep(101105250) phosphatidylinositol 4-kinase type 2 beta
Domestic Rabbit(100345479) phosphatidylinositol 4-kinase type 2 beta
naked mole-rat(101700160) phosphatidylinositol 4-kinase type 2 beta
domestic guinea pig(100717919) phosphatidylinositol 4-kinase type 2 beta
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018323 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018323 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018323 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025951 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025951 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025951 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018323 Rosetta Predictions human pricing
NM_001005883 Rosetta Predictions rat pricing
NM_025951 Rosetta Predictions mouse pricing
NM_028744 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018323 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00212532 predicted 1419
2 SASI_Hs01_00212533 predicted 565
3 SASI_Hs02_00351756 predicted 449
4 SASI_Hs01_00212537 predicted 830
5 SASI_Hs01_00212538 predicted 416
6 SASI_Hs02_00351757 predicted 1104
7 SASI_Hs02_00351758 predicted 1265
8 SASI_Hs01_00212539 predicted 547
9 SASI_Hs02_00351759 predicted 1559
10 SASI_Hs01_00212540 predicted 487
11 SASI_Hs01_00212531 predicted 981
12 SASI_Hs01_00212534 predicted 1178
13 SASI_Hs01_00212535 predicted 1587
14 SASI_Hs01_00212536 predicted 1627
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005883 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00084343 predicted 1106
2 SASI_Rn01_00084345 predicted 1039
3 SASI_Rn01_00084346 predicted 768
4 SASI_Rn01_00084348 predicted 531
5 SASI_Rn02_00198456 predicted 1187
6 SASI_Rn01_00084349 predicted 841
7 SASI_Rn02_00198457 predicted 1300
8 SASI_Rn01_00084350 predicted 1054
9 SASI_Rn01_00084351 predicted 378
10 SASI_Rn01_00084352 predicted 972
11 SASI_Rn01_00084344 predicted 932
12 SASI_Rn01_00084347 predicted 1107
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025951 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00329346 predicted 1641
2 SASI_Mm02_00329347 predicted 1097
3 SASI_Mm02_00329348 predicted 1255
4 SASI_Mm02_00329349 predicted 1085
5 SASI_Mm02_00329350 predicted 1559
6 SASI_Mm01_00171620 predicted 1368
7 SASI_Mm02_00329351 predicted 1248
8 SASI_Mm01_00171622 predicted 1361
9 SASI_Mm02_00329352 predicted 1166
10 SASI_Mm02_00329353 predicted 1089
11 SASI_Mm01_00171619 predicted 1256
12 SASI_Mm01_00171621 predicted 1338
13 SASI_Mm01_00171623 predicted 1260
14 SASI_Mm01_00171624 predicted 1327
15 SASI_Mm01_00171625 predicted 1357
16 SASI_Mm01_00171626 predicted 1289
17 SASI_Mm01_00171627 predicted 1336
18 SASI_Mm01_00171628 predicted 1258
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028744 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00334318 predicted 1580
2 SASI_Mm02_00334319 predicted 1026
3 SASI_Mm02_00334320 predicted 1182
4 SASI_Mm02_00334321 predicted 1015
5 SASI_Mm02_00334322 predicted 1492
6 SASI_Mm01_00112445 predicted 1290
7 SASI_Mm02_00334323 predicted 1175
8 SASI_Mm01_00112447 predicted 1291
9 SASI_Mm02_00334324 predicted 1098
10 SASI_Mm02_00334325 predicted 1019
11 SASI_Mm01_00112444 predicted 1183
12 SASI_Mm01_00112446 predicted 1267
13 SASI_Mm01_00112448 predicted 1192
14 SASI_Mm01_00112449 predicted 1263
15 SASI_Mm01_00112450 predicted 1286
16 SASI_Mm01_00112451 predicted 1223
17 SASI_Mm01_00112452 predicted 1272
18 SASI_Mm01_00112453 predicted 1181
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018323
VALIDATED
PI4K2B MISSION shRNA Bacterial Glycerol Stock
phosphatidylinositol 4-kinase type 2 beta
Human
19 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000194791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_018323.2-1029s1c1
Sequence:CCGGCAATGATAATTGGTTAGTCAGCTCGAGCTGACTAACCAATTATCATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_018323.2-1132s1c1
Sequence:CCGGGCTGCAATTGATAATGGTCTACTCGAGTAGACCATTATCAATTGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_018323.2-1273s1c1
Sequence:CCGGGACATGAACTTTGTGCAAGATCTCGAGATCTTGCACAAAGTTCATGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_018323.2-858s1c1
Sequence:CCGGCCCTCCTAAGATTGGTTCCTTCTCGAGAAGGAACCAATCTTAGGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_018323.2-1423s1c1
Sequence:CCGGCCTTTCCAGCTAGTACAGATACTCGAGTATCTGTACTAGCTGGAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_018323.2-420s1c1
Sequence:CCGGCCCAGAATTTGCTGATATTATCTCGAGATAATATCAGCAAATTCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_018323.2-1287s1c1
Sequence:CCGGGCAAGATTTATGTGAAGATCTCTCGAGAGATCTTCACATAAATCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_018323.2-419s21c1
Sequence:CCGGACCCAGAATTTGCTGATATTACTCGAGTAATATCAGCAAATTCTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229847    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_018323.2-2059s21c1
Sequence:CCGGACTCCTAAAGTGACCATTATTCTCGAGAATAATGGTCACTTTAGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_018323.2-709s1c1
Sequence:CCGGCATCTGAGCATTGTACCTAAACTCGAGTTTAGGTACAATGCTCAGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_018323.2-493s1c1
Sequence:CCGGCAAGGTTCAAGTGGAAGTTACCTCGAGGTAACTTCCACTTGAACCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_018323.2-1171s1c1
Sequence:CCGGCCTGATGAATGGAGAGCATATCTCGAGATATGCTCTCCATTCATCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_018323.2-377s1c1
Sequence:CCGGCAGTAACTATTGGTACTTCAGCTCGAGCTGAAGTACCAATAGTTACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196488    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_018323.2-1887s1c1
Sequence:CCGGGAGAAGAATGTTCATGCTAATCTCGAGATTAGCATGAACATTCTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196629    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_018323.2-2349s1c1
Sequence:CCGGGTACTGGCCTTGTTCAATTTACTCGAGTAAATTGAACAAGGCCAGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_018323.2-867s1c1
Sequence:CCGGGATTGGTTCCTTTCAGTTATTCTCGAGAATAACTGAAAGGAACCAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_018323.2-1177s21c1
Sequence:GTACCGGGAATGGAGAGCATATCCATTTCTCGAGAAATGGATATGCTCTCCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018323.2-594s21c1
Sequence:GTACCGGATGGACCAAATATGTCCATAACTCGAGTTATGGACATATTTGGTCCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_018323.2-368s21c1
Sequence:CCGGCCGCGGTTTCAGTAACTATTGCTCGAGCAATAGTTACTGAAACCGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018323
VALIDATED
PI4K2B MISSION shRNA shRNA Plasmid DNA
phosphatidylinositol 4-kinase type 2 beta
Human
19 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000194791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_018323.2-1029s1c1
Sequence:CCGGCAATGATAATTGGTTAGTCAGCTCGAGCTGACTAACCAATTATCATTGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000037587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_018323.2-1132s1c1
Sequence:CCGGGCTGCAATTGATAATGGTCTACTCGAGTAGACCATTATCAATTGCAGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000037588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_018323.2-1273s1c1
Sequence:CCGGGACATGAACTTTGTGCAAGATCTCGAGATCTTGCACAAAGTTCATGTCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000037585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_018323.2-858s1c1
Sequence:CCGGCCCTCCTAAGATTGGTTCCTTCTCGAGAAGGAACCAATCTTAGGAGGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000037586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_018323.2-1423s1c1
Sequence:CCGGCCTTTCCAGCTAGTACAGATACTCGAGTATCTGTACTAGCTGGAAAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000037584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_018323.2-420s1c1
Sequence:CCGGCCCAGAATTTGCTGATATTATCTCGAGATAATATCAGCAAATTCTGGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000196628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_018323.2-1287s1c1
Sequence:CCGGGCAAGATTTATGTGAAGATCTCTCGAGAGATCTTCACATAAATCTTGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000229846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_018323.2-419s21c1
Sequence:CCGGACCCAGAATTTGCTGATATTACTCGAGTAATATCAGCAAATTCTGGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000229847    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_018323.2-2059s21c1
Sequence:CCGGACTCCTAAAGTGACCATTATTCTCGAGAATAATGGTCACTTTAGGAGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000194997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_018323.2-709s1c1
Sequence:CCGGCATCTGAGCATTGTACCTAAACTCGAGTTTAGGTACAATGCTCAGATGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000195310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_018323.2-493s1c1
Sequence:CCGGCAAGGTTCAAGTGGAAGTTACCTCGAGGTAACTTCCACTTGAACCTTGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000195443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_018323.2-1171s1c1
Sequence:CCGGCCTGATGAATGGAGAGCATATCTCGAGATATGCTCTCCATTCATCAGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000195735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_018323.2-377s1c1
Sequence:CCGGCAGTAACTATTGGTACTTCAGCTCGAGCTGAAGTACCAATAGTTACTGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000196488    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_018323.2-1887s1c1
Sequence:CCGGGAGAAGAATGTTCATGCTAATCTCGAGATTAGCATGAACATTCTTCTCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000196629    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_018323.2-2349s1c1
Sequence:CCGGGTACTGGCCTTGTTCAATTTACTCGAGTAAATTGAACAAGGCCAGTACTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000196739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_018323.2-867s1c1
Sequence:CCGGGATTGGTTCCTTTCAGTTATTCTCGAGAATAACTGAAAGGAACCAATCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000217963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_018323.2-1177s21c1
Sequence:GTACCGGGAATGGAGAGCATATCCATTTCTCGAGAAATGGATATGCTCTCCATTCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000218617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018323.2-594s21c1
Sequence:GTACCGGATGGACCAAATATGTCCATAACTCGAGTTATGGACATATTTGGTCCATTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000229845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_018323.2-368s21c1
Sequence:CCGGCCGCGGTTTCAGTAACTATTGCTCGAGCAATAGTTACTGAAACCGCGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018323
VALIDATED
PI4K2B MISSION shRNA Lentiviral Transduction Particles
phosphatidylinositol 4-kinase type 2 beta
Human
19 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000194791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_018323.2-1029s1c1
Sequence:CCGGCAATGATAATTGGTTAGTCAGCTCGAGCTGACTAACCAATTATCATTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_018323.2-1132s1c1
Sequence:CCGGGCTGCAATTGATAATGGTCTACTCGAGTAGACCATTATCAATTGCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_018323.2-1273s1c1
Sequence:CCGGGACATGAACTTTGTGCAAGATCTCGAGATCTTGCACAAAGTTCATGTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_018323.2-858s1c1
Sequence:CCGGCCCTCCTAAGATTGGTTCCTTCTCGAGAAGGAACCAATCTTAGGAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_018323.2-1423s1c1
Sequence:CCGGCCTTTCCAGCTAGTACAGATACTCGAGTATCTGTACTAGCTGGAAAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_018323.2-420s1c1
Sequence:CCGGCCCAGAATTTGCTGATATTATCTCGAGATAATATCAGCAAATTCTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_018323.2-1287s1c1
Sequence:CCGGGCAAGATTTATGTGAAGATCTCTCGAGAGATCTTCACATAAATCTTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_018323.2-419s21c1
Sequence:CCGGACCCAGAATTTGCTGATATTACTCGAGTAATATCAGCAAATTCTGGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229847    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_018323.2-2059s21c1
Sequence:CCGGACTCCTAAAGTGACCATTATTCTCGAGAATAATGGTCACTTTAGGAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_018323.2-709s1c1
Sequence:CCGGCATCTGAGCATTGTACCTAAACTCGAGTTTAGGTACAATGCTCAGATGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_018323.2-493s1c1
Sequence:CCGGCAAGGTTCAAGTGGAAGTTACCTCGAGGTAACTTCCACTTGAACCTTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_018323.2-1171s1c1
Sequence:CCGGCCTGATGAATGGAGAGCATATCTCGAGATATGCTCTCCATTCATCAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_018323.2-377s1c1
Sequence:CCGGCAGTAACTATTGGTACTTCAGCTCGAGCTGAAGTACCAATAGTTACTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196488    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_018323.2-1887s1c1
Sequence:CCGGGAGAAGAATGTTCATGCTAATCTCGAGATTAGCATGAACATTCTTCTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196629    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_018323.2-2349s1c1
Sequence:CCGGGTACTGGCCTTGTTCAATTTACTCGAGTAAATTGAACAAGGCCAGTACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_018323.2-867s1c1
Sequence:CCGGGATTGGTTCCTTTCAGTTATTCTCGAGAATAACTGAAAGGAACCAATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_018323.2-1177s21c1
Sequence:GTACCGGGAATGGAGAGCATATCCATTTCTCGAGAAATGGATATGCTCTCCATTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018323.2-594s21c1
Sequence:GTACCGGATGGACCAAATATGTCCATAACTCGAGTTATGGACATATTTGGTCCATTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_018323.2-368s21c1
Sequence:CCGGCCGCGGTTTCAGTAACTATTGCTCGAGCAATAGTTACTGAAACCGCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025951
VALIDATED
PI4K2B MISSION shRNA Bacterial Glycerol Stock
phosphatidylinositol 4-kinase type 2 beta
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000024866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025951.1-350s1c1
Sequence:CCGGCGAGCTCAGAAACAAATACATCTCGAGATGTATTTGTTTCTGAGCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025951.1-1048s1c1
Sequence:CCGGGAGGAATCAAACTGGATTGATCTCGAGATCAATCCAGTTTGATTCCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025951.1-1132s1c1
Sequence:CCGGCCTGATGAATGGCGAGCATATCTCGAGATATGCTCGCCATTCATCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025951.1-555s1c1
Sequence:CCGGGTGGACCAAGTACGTCCATAACTCGAGTTATGGACGTACTTGGTCCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025951.1-843s1c1
Sequence:CCGGGCTGTTTGTGAAAGATTACAACTCGAGTTGTAATCTTTCACAAACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361831    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025951.2-2016s21c1
Sequence:CCGGAGAGCGGACAGTGATAGTAAACTCGAGTTTACTATCACTGTCCGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025951.2-1248s21c1
Sequence:CCGGACTTGATTCTACCCTATATTTCTCGAGAAATATAGGGTAGAATCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025951.2-1029s21c1
Sequence:CCGGATGATAACTGGCTAGTCAAATCTCGAGATTTGACTAGCCAGTTATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025951
VALIDATED
PI4K2B MISSION shRNA shRNA Plasmid DNA
phosphatidylinositol 4-kinase type 2 beta
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000024866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025951.1-350s1c1
Sequence:CCGGCGAGCTCAGAAACAAATACATCTCGAGATGTATTTGTTTCTGAGCTCGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000024868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025951.1-1048s1c1
Sequence:CCGGGAGGAATCAAACTGGATTGATCTCGAGATCAATCCAGTTTGATTCCTCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000024864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025951.1-1132s1c1
Sequence:CCGGCCTGATGAATGGCGAGCATATCTCGAGATATGCTCGCCATTCATCAGGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000024867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025951.1-555s1c1
Sequence:CCGGGTGGACCAAGTACGTCCATAACTCGAGTTATGGACGTACTTGGTCCACTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000024865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025951.1-843s1c1
Sequence:CCGGGCTGTTTGTGAAAGATTACAACTCGAGTTGTAATCTTTCACAAACAGCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000361831    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025951.2-2016s21c1
Sequence:CCGGAGAGCGGACAGTGATAGTAAACTCGAGTTTACTATCACTGTCCGCTCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000361772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025951.2-1248s21c1
Sequence:CCGGACTTGATTCTACCCTATATTTCTCGAGAAATATAGGGTAGAATCAAGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000361773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025951.2-1029s21c1
Sequence:CCGGATGATAACTGGCTAGTCAAATCTCGAGATTTGACTAGCCAGTTATCATTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025951
VALIDATED
PI4K2B MISSION shRNA Lentiviral Transduction Particles
phosphatidylinositol 4-kinase type 2 beta
Mouse
8 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000024866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025951.1-350s1c1
Sequence:CCGGCGAGCTCAGAAACAAATACATCTCGAGATGTATTTGTTTCTGAGCTCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025951.1-1048s1c1
Sequence:CCGGGAGGAATCAAACTGGATTGATCTCGAGATCAATCCAGTTTGATTCCTCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025951.1-1132s1c1
Sequence:CCGGCCTGATGAATGGCGAGCATATCTCGAGATATGCTCGCCATTCATCAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025951.1-555s1c1
Sequence:CCGGGTGGACCAAGTACGTCCATAACTCGAGTTATGGACGTACTTGGTCCACTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025951.1-843s1c1
Sequence:CCGGGCTGTTTGTGAAAGATTACAACTCGAGTTGTAATCTTTCACAAACAGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361831    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025951.2-2016s21c1
Sequence:CCGGAGAGCGGACAGTGATAGTAAACTCGAGTTTACTATCACTGTCCGCTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025951.2-1248s21c1
Sequence:CCGGACTTGATTCTACCCTATATTTCTCGAGAAATATAGGGTAGAATCAAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025951.2-1029s21c1
Sequence:CCGGATGATAACTGGCTAGTCAAATCTCGAGATTTGACTAGCCAGTTATCATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)