EMAIL THIS PAGE TO A FRIEND

PI4KB

phosphatidylinositol 4-kinase, catalytic, beta

76 Gene Product Result for
Synonyms: NPIK PI4K-BETA PI4K92 PI4KBETA PI4KIIIBETA PIK4CB
Gene ID:
Mouse(107650) phosphatidylinositol 4-kinase, catalytic, beta polypeptide
Rat(81747) phosphatidylinositol 4-kinase, catalytic, beta
Zebrafish(563201) phosphatidylinositol 4-kinase, catalytic, beta
chicken(425661) phosphatidylinositol 4-kinase, catalytic, beta
dog(483196) phosphatidylinositol 4-kinase, catalytic, beta
Horse(100055429) phosphatidylinositol 4-kinase, catalytic, beta
domestic cat(101099066) phosphatidylinositol 4-kinase, catalytic, beta
cow(286846) phosphatidylinositol 4-kinase, catalytic, beta
sheep(101115244) phosphatidylinositol 4-kinase, catalytic, beta
Domestic Rabbit(100328671) phosphatidylinositol 4-kinase, catalytic, beta
naked mole-rat(101700192) phosphatidylinositol 4-kinase, catalytic, beta
domestic guinea pig(100717511) phosphatidylinositol 4-kinase, catalytic, beta
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175356 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175356 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175356 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002651 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002651 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002651 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002651 Rosetta Predictions human pricing
NM_031083 Rosetta Predictions rat pricing
NM_175356 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002651 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00149544 predicted 1401
2 SASI_Hs01_00149545 predicted 1533
3 SASI_Hs01_00149546 predicted 1025
4 SASI_Hs01_00149547 predicted 576
5 SASI_Hs01_00149549 predicted 2350
6 SASI_Hs01_00149550 predicted 2644
7 SASI_Hs01_00149551 predicted 449
8 SASI_Hs01_00149552 predicted 1445
9 SASI_Hs02_00334193 predicted 1532
10 SASI_Hs01_00149553 predicted 2018
11 SASI_Hs01_00149548 predicted 757
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031083 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00041447 predicted 1708
2 SASI_Rn01_00041448 predicted 1291
3 SASI_Rn01_00041450 predicted 614
4 SASI_Rn01_00041451 predicted 838
5 SASI_Rn01_00041452 predicted 2529
6 SASI_Rn01_00041453 predicted 2613
7 SASI_Rn01_00041454 predicted 1797
8 SASI_Rn01_00041456 predicted 2019
9 SASI_Rn02_00264323 predicted 940
10 SASI_Rn02_00264324 predicted 2146
11 SASI_Rn01_00041449 predicted 1875
12 SASI_Rn01_00041455 predicted 2508
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175356 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00080645 predicted 624
2 SASI_Mm01_00080646 predicted 1080
3 SASI_Mm01_00080647 predicted 1206
4 SASI_Mm01_00080648 predicted 842
5 SASI_Mm01_00080650 predicted 2577
6 SASI_Mm02_00346153 predicted 871
7 SASI_Mm01_00080651 predicted 2811
8 SASI_Mm01_00080652 predicted 2477
9 SASI_Mm01_00080653 predicted 2242
10 SASI_Mm02_00346154 predicted 1877
11 SASI_Mm01_00080649 predicted 1375
12 SASI_Mm01_00080654 predicted 1990
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175356
VALIDATED
PI4KB MISSION shRNA Bacterial Glycerol Stock
phosphatidylinositol 4-kinase, catalytic, beta
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378487    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175356.2-3170s21c1
Sequence:CCGGGAGTAGGTTCTTGGTACTTAGCTCGAGCTAAGTACCAAGAACCTACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175356.2-1135s21c1
Sequence:CCGGAGAGGGAGCTGCCGACATTAACTCGAGTTAATGTCGGCAGCTCCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175356.2-799s21c1
Sequence:CCGGTTGACATCTCTATGGCTATTTCTCGAGAAATAGCCATAGAGATGTCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175356.1-2499s1c1
Sequence:CCGGCGGTGATATGTTCAACTACTACTCGAGTAGTAGTTGAACATATCACCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175356.1-2646s1c1
Sequence:CCGGCCTCAAAGAGAGGTTCCACATCTCGAGATGTGGAACCTCTCTTTGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175356.1-1705s1c1
Sequence:CCGGGCCTGGTCAGTGGATGATATACTCGAGTATATCATCCACTGACCAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175356.1-1087s1c1
Sequence:CCGGCGGAAGCTAATCCTCTCAGATCTCGAGATCTGAGAGGATTAGCTTCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175356.1-1308s1c1
Sequence:CCGGGCGAGAATTCATCAAGTCTTTCTCGAGAAAGACTTGATGAATTCTCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175356
VALIDATED
PI4KB MISSION shRNA shRNA Plasmid DNA
phosphatidylinositol 4-kinase, catalytic, beta
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378487    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175356.2-3170s21c1
Sequence:CCGGGAGTAGGTTCTTGGTACTTAGCTCGAGCTAAGTACCAAGAACCTACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175356.2-1135s21c1
Sequence:CCGGAGAGGGAGCTGCCGACATTAACTCGAGTTAATGTCGGCAGCTCCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175356.2-799s21c1
Sequence:CCGGTTGACATCTCTATGGCTATTTCTCGAGAAATAGCCATAGAGATGTCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175356.1-2499s1c1
Sequence:CCGGCGGTGATATGTTCAACTACTACTCGAGTAGTAGTTGAACATATCACCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175356.1-2646s1c1
Sequence:CCGGCCTCAAAGAGAGGTTCCACATCTCGAGATGTGGAACCTCTCTTTGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175356.1-1705s1c1
Sequence:CCGGGCCTGGTCAGTGGATGATATACTCGAGTATATCATCCACTGACCAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175356.1-1087s1c1
Sequence:CCGGCGGAAGCTAATCCTCTCAGATCTCGAGATCTGAGAGGATTAGCTTCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175356.1-1308s1c1
Sequence:CCGGGCGAGAATTCATCAAGTCTTTCTCGAGAAAGACTTGATGAATTCTCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175356
VALIDATED
PI4KB MISSION shRNA Lentiviral Transduction Particles
phosphatidylinositol 4-kinase, catalytic, beta
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378487    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175356.2-3170s21c1
Sequence:CCGGGAGTAGGTTCTTGGTACTTAGCTCGAGCTAAGTACCAAGAACCTACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175356.2-1135s21c1
Sequence:CCGGAGAGGGAGCTGCCGACATTAACTCGAGTTAATGTCGGCAGCTCCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175356.2-799s21c1
Sequence:CCGGTTGACATCTCTATGGCTATTTCTCGAGAAATAGCCATAGAGATGTCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175356.1-2499s1c1
Sequence:CCGGCGGTGATATGTTCAACTACTACTCGAGTAGTAGTTGAACATATCACCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175356.1-2646s1c1
Sequence:CCGGCCTCAAAGAGAGGTTCCACATCTCGAGATGTGGAACCTCTCTTTGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175356.1-1705s1c1
Sequence:CCGGGCCTGGTCAGTGGATGATATACTCGAGTATATCATCCACTGACCAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175356.1-1087s1c1
Sequence:CCGGCGGAAGCTAATCCTCTCAGATCTCGAGATCTGAGAGGATTAGCTTCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175356.1-1308s1c1
Sequence:CCGGGCGAGAATTCATCAAGTCTTTCTCGAGAAAGACTTGATGAATTCTCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002651
VALIDATED
PI4KB MISSION shRNA Bacterial Glycerol Stock
phosphatidylinositol 4-kinase, catalytic, beta
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000197011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002651.1-361s1c1
Sequence:CCGGGAGATCCGTTGCCTAGATGATCTCGAGATCATCTAGGCAACGGATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199262    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_002651.1-2903s1c1
Sequence:CCGGCCACAGGCCATCCTCTTATTCCTCGAGGAATAAGAGGATGGCCTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342669    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002651.1-2678s21c1
Sequence:CCGGGCAAGAAACACGAAGGATCATCTCGAGATGATCCTTCGTGTTTCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002651.1-636s21c1
Sequence:CCGGCCAGTTGCTTAACATGTACATCTCGAGATGTACATGTTAAGCAACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002651.1-2274s1c1
Sequence:CCGGCGACATGTTCAACTACTATAACTCGAGTTATAGTAGTTGAACATGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005692    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_002651.1-2958s1c1
Sequence:CCGGTCTCGGTACTTAGGACTTGATCTCGAGATCAAGTCCTAAGTACCGAGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197169    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_002651.1-2678s1c1
Sequence:CCGGGCAAGAAACACGAAGGATCATCTCGAGATGATCCTTCGTGTTTCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_002651.1-1894s1c1
Sequence:CCGGCCATACAAGATTCTTGTGATTCTCGAGAATCACAAGAATCTTGTATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002651.1-1031s1c1
Sequence:CCGGCCGAGAGTATTGATAATTCATCTCGAGATGAATTATCAATACTCTCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_002651.1-636s1c1
Sequence:CCGGCCAGTTGCTTAACATGTACATCTCGAGATGTACATGTTAAGCAACTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_002651.1-2485s1c1
Sequence:CCGGGATGGCAGTATGCGGTCTATCCTCGAGGATAGACCGCATACTGCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002651
VALIDATED
PI4KB MISSION shRNA shRNA Plasmid DNA
phosphatidylinositol 4-kinase, catalytic, beta
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000197011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002651.1-361s1c1
Sequence:CCGGGAGATCCGTTGCCTAGATGATCTCGAGATCATCTAGGCAACGGATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199262    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_002651.1-2903s1c1
Sequence:CCGGCCACAGGCCATCCTCTTATTCCTCGAGGAATAAGAGGATGGCCTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342669    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002651.1-2678s21c1
Sequence:CCGGGCAAGAAACACGAAGGATCATCTCGAGATGATCCTTCGTGTTTCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002651.1-636s21c1
Sequence:CCGGCCAGTTGCTTAACATGTACATCTCGAGATGTACATGTTAAGCAACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002651.1-2274s1c1
Sequence:CCGGCGACATGTTCAACTACTATAACTCGAGTTATAGTAGTTGAACATGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005692    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_002651.1-2958s1c1
Sequence:CCGGTCTCGGTACTTAGGACTTGATCTCGAGATCAAGTCCTAAGTACCGAGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197169    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_002651.1-2678s1c1
Sequence:CCGGGCAAGAAACACGAAGGATCATCTCGAGATGATCCTTCGTGTTTCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_002651.1-1894s1c1
Sequence:CCGGCCATACAAGATTCTTGTGATTCTCGAGAATCACAAGAATCTTGTATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002651.1-1031s1c1
Sequence:CCGGCCGAGAGTATTGATAATTCATCTCGAGATGAATTATCAATACTCTCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_002651.1-636s1c1
Sequence:CCGGCCAGTTGCTTAACATGTACATCTCGAGATGTACATGTTAAGCAACTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_002651.1-2485s1c1
Sequence:CCGGGATGGCAGTATGCGGTCTATCCTCGAGGATAGACCGCATACTGCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002651
VALIDATED
PI4KB MISSION shRNA Lentiviral Transduction Particles
phosphatidylinositol 4-kinase, catalytic, beta
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000197011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002651.1-361s1c1
Sequence:CCGGGAGATCCGTTGCCTAGATGATCTCGAGATCATCTAGGCAACGGATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199262    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_002651.1-2903s1c1
Sequence:CCGGCCACAGGCCATCCTCTTATTCCTCGAGGAATAAGAGGATGGCCTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342669    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002651.1-2678s21c1
Sequence:CCGGGCAAGAAACACGAAGGATCATCTCGAGATGATCCTTCGTGTTTCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002651.1-636s21c1
Sequence:CCGGCCAGTTGCTTAACATGTACATCTCGAGATGTACATGTTAAGCAACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002651.1-2274s1c1
Sequence:CCGGCGACATGTTCAACTACTATAACTCGAGTTATAGTAGTTGAACATGTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005692    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_002651.1-2958s1c1
Sequence:CCGGTCTCGGTACTTAGGACTTGATCTCGAGATCAAGTCCTAAGTACCGAGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197169    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_002651.1-2678s1c1
Sequence:CCGGGCAAGAAACACGAAGGATCATCTCGAGATGATCCTTCGTGTTTCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_002651.1-1894s1c1
Sequence:CCGGCCATACAAGATTCTTGTGATTCTCGAGAATCACAAGAATCTTGTATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002651.1-1031s1c1
Sequence:CCGGCCGAGAGTATTGATAATTCATCTCGAGATGAATTATCAATACTCTCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_002651.1-636s1c1
Sequence:CCGGCCAGTTGCTTAACATGTACATCTCGAGATGTACATGTTAAGCAACTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_002651.1-2485s1c1
Sequence:CCGGGATGGCAGTATGCGGTCTATCCTCGAGGATAGACCGCATACTGCCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)