EMAIL THIS PAGE TO A FRIEND

PIAS3

protein inhibitor of activated STAT, 3

127 Gene Product Result for
Synonyms: ZMIZ5
UniProtKB ID: Q9Y6X2, Q9UFI3
Gene ID:
Human(10401) Summary: This gene encodes a member of the PIAS [protein inhibitor of activated STAT (signal transducer and activator of transcription)]
Mouse(229615) protein inhibitor of activated STAT 3
Rat(83614) protein inhibitor of activated STAT, 3
cow(535312) protein inhibitor of activated STAT, 3
sheep(101116875) protein inhibitor of activated STAT, 3
naked mole-rat(101699952) protein inhibitor of activated STAT, 3
domestic guinea pig(100730313) protein inhibitor of activated STAT, 3
dog(483160) protein inhibitor of activated STAT, 3
domestic cat(101097748) protein inhibitor of activated STAT, 3
Horse(100065141) protein inhibitor of activated STAT, 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018812 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018812 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018812 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006099 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006099 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006099 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006099 Rosetta Predictions human pricing
NM_031784 Rosetta Predictions rat pricing
NM_018812 Rosetta Predictions mouse pricing
NM_146135 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006099 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00137221 predicted 994
2 SASI_Hs01_00137223 predicted 899
3 SASI_Hs01_00137224 predicted 1222
4 SASI_Hs01_00137225 predicted 887
5 SASI_Hs01_00137226 predicted 659
6 SASI_Hs01_00137227 predicted 1156
7 SASI_Hs01_00137228 predicted 543
8 SASI_Hs01_00137229 predicted 267
9 SASI_Hs01_00137230 predicted 1134
10 SASI_Hs02_00340885 predicted 957
11 SASI_Hs01_00137222 predicted 961
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031784 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00058755 predicted 1932
2 SASI_Rn01_00058756 predicted 873
3 SASI_Rn01_00058757 predicted 956
4 SASI_Rn01_00058758 predicted 1567
5 SASI_Rn01_00058759 predicted 1986
6 SASI_Rn01_00058760 predicted 719
7 SASI_Rn01_00058761 predicted 1193
8 SASI_Rn01_00058762 predicted 1356
9 SASI_Rn01_00058763 predicted 853
10 SASI_Rn01_00058764 predicted 840
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018812 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00149427 predicted 994
2 SASI_Mm02_00324151 predicted 1067
3 SASI_Mm01_00149428 predicted 992
4 SASI_Mm01_00149429 predicted 1040
5 SASI_Mm01_00149430 predicted 1021
6 SASI_Mm01_00149431 predicted 998
7 SASI_Mm01_00149432 predicted 991
8 SASI_Mm01_00149433 predicted 991
9 SASI_Mm01_00149434 predicted 995
10 SASI_Mm01_00149436 predicted 1092
11 SASI_Mm01_00149435 predicted 1007
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146135 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00193480 predicted 1161
2 SASI_Mm02_00341825 predicted 1246
3 SASI_Mm01_00193481 predicted 1166
4 SASI_Mm01_00193482 predicted 1204
5 SASI_Mm01_00193483 predicted 1194
6 SASI_Mm01_00193484 predicted 1165
7 SASI_Mm01_00193485 predicted 1163
8 SASI_Mm01_00193486 predicted 1166
9 SASI_Mm01_00193487 predicted 1166
10 SASI_Mm01_00193489 predicted 1266
11 SASI_Mm01_00193488 predicted 1177
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018812
PIAS3 MISSION shRNA Bacterial Glycerol Stock
protein inhibitor of activated STAT, 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018812.1-988s21c1
Sequence:CCGGCCCTATGAGTCGCTGATTATTCTCGAGAATAATCAGCGACTCATAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018812.1-497s21c1
Sequence:CCGGACCTCTTTGTTAAGGTTAATGCTCGAGCATTAACCTTAACAAAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018812.1-469s21c1
Sequence:CCGGTGCCCTCAGGAGGACTATTTCCTCGAGGAAATAGTCCTCCTGAGGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018812.1-638s1c1
Sequence:CCGGCCATCGTTATTAATTGGTCATCTCGAGATGACCAATTAATAACGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018812.1-493s1c1
Sequence:CCGGCCTAACCTCTTTGTTAAGGTTCTCGAGAACCTTAACAAAGAGGTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018812.1-1498s1c1
Sequence:CCGGCCTTCAGTTATCATCTCGCTACTCGAGTAGCGAGATGATAACTGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018812.1-1438s1c1
Sequence:CCGGGCTGACATCCAAGGTTTAGATCTCGAGATCTAAACCTTGGATGTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018812.1-998s1c1
Sequence:CCGGCGCTGATTATTGATGGTTTATCTCGAGATAAACCATCAATAATCAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018812.1-128s21c1
Sequence:CCGGGCGTCCAGATGAAGATCAAAGCTCGAGCTTTGATCTTCATCTGGACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018812.1-657s21c1
Sequence:CCGGATCTGAGTTTGGACGGAATTACTCGAGTAATTCCGTCCAAACTCAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018812
PIAS3 MISSION shRNA shRNA Plasmid DNA
protein inhibitor of activated STAT, 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018812.1-988s21c1
Sequence:CCGGCCCTATGAGTCGCTGATTATTCTCGAGAATAATCAGCGACTCATAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018812.1-497s21c1
Sequence:CCGGACCTCTTTGTTAAGGTTAATGCTCGAGCATTAACCTTAACAAAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018812.1-469s21c1
Sequence:CCGGTGCCCTCAGGAGGACTATTTCCTCGAGGAAATAGTCCTCCTGAGGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018812.1-638s1c1
Sequence:CCGGCCATCGTTATTAATTGGTCATCTCGAGATGACCAATTAATAACGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018812.1-493s1c1
Sequence:CCGGCCTAACCTCTTTGTTAAGGTTCTCGAGAACCTTAACAAAGAGGTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018812.1-1498s1c1
Sequence:CCGGCCTTCAGTTATCATCTCGCTACTCGAGTAGCGAGATGATAACTGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018812.1-1438s1c1
Sequence:CCGGGCTGACATCCAAGGTTTAGATCTCGAGATCTAAACCTTGGATGTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018812.1-998s1c1
Sequence:CCGGCGCTGATTATTGATGGTTTATCTCGAGATAAACCATCAATAATCAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018812.1-128s21c1
Sequence:CCGGGCGTCCAGATGAAGATCAAAGCTCGAGCTTTGATCTTCATCTGGACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018812.1-657s21c1
Sequence:CCGGATCTGAGTTTGGACGGAATTACTCGAGTAATTCCGTCCAAACTCAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018812
PIAS3 MISSION shRNA Lentiviral Transduction Particles
protein inhibitor of activated STAT, 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018812.1-988s21c1
Sequence:CCGGCCCTATGAGTCGCTGATTATTCTCGAGAATAATCAGCGACTCATAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018812.1-497s21c1
Sequence:CCGGACCTCTTTGTTAAGGTTAATGCTCGAGCATTAACCTTAACAAAGAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018812.1-469s21c1
Sequence:CCGGTGCCCTCAGGAGGACTATTTCCTCGAGGAAATAGTCCTCCTGAGGGCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018812.1-638s1c1
Sequence:CCGGCCATCGTTATTAATTGGTCATCTCGAGATGACCAATTAATAACGATGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018812.1-493s1c1
Sequence:CCGGCCTAACCTCTTTGTTAAGGTTCTCGAGAACCTTAACAAAGAGGTTAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018812.1-1498s1c1
Sequence:CCGGCCTTCAGTTATCATCTCGCTACTCGAGTAGCGAGATGATAACTGAAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018812.1-1438s1c1
Sequence:CCGGGCTGACATCCAAGGTTTAGATCTCGAGATCTAAACCTTGGATGTCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018812.1-998s1c1
Sequence:CCGGCGCTGATTATTGATGGTTTATCTCGAGATAAACCATCAATAATCAGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018812.1-128s21c1
Sequence:CCGGGCGTCCAGATGAAGATCAAAGCTCGAGCTTTGATCTTCATCTGGACGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018812.1-657s21c1
Sequence:CCGGATCTGAGTTTGGACGGAATTACTCGAGTAATTCCGTCCAAACTCAGATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006099
VALIDATED
PIAS3 MISSION shRNA Bacterial Glycerol Stock
protein inhibitor of activated STAT, 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000274273    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006099.3-2137s21c1
Sequence:CCGGCAGCACCCAAAGGGTTAATATCTCGAGATATTAACCCTTTGGGTGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006099.3-1662s21c1
Sequence:CCGGCCGACATCCAAGGTTTAGATTCTCGAGAATCTAAACCTTGGATGTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006099.3-1947s21c1
Sequence:CCGGGCTGTCGGTCAGACATCATTTCTCGAGAAATGATGTCTGACCGACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006099.3-880s21c1
Sequence:CCGGATCTGAGTTCGGACGGAATTACTCGAGTAATTCCGTCCGAACTCAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020784    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006099.2-2834s1c1
Sequence:CCGGCCCATAATAAAGGTTGTGAATCTCGAGATTCACAACCTTTATTATGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006099.2-128s1c1
Sequence:CCGGCCGGAACAAGAGTGGACGGAACTCGAGTTCCGTCCACTCTTGTTCCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006099.2-1618s1c1
Sequence:CCGGCCGACATCCAAGGTTTAGATTCTCGAGAATCTAAACCTTGGATGTCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006099.2-1903s1c1
Sequence:CCGGGCTGTCGGTCAGACATCATTTCTCGAGAAATGATGTCTGACCGACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006099.2-1167s1c1
Sequence:CCGGCCCTATGAATCTCTTATCATTCTCGAGAATGATAAGAGATTCATAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006099.3-1211s21c1
Sequence:CCGGCCCTATGAATCTCTTATCATTCTCGAGAATGATAAGAGATTCATAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006099
VALIDATED
PIAS3 MISSION shRNA shRNA Plasmid DNA
protein inhibitor of activated STAT, 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000274273    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006099.3-2137s21c1
Sequence:CCGGCAGCACCCAAAGGGTTAATATCTCGAGATATTAACCCTTTGGGTGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006099.3-1662s21c1
Sequence:CCGGCCGACATCCAAGGTTTAGATTCTCGAGAATCTAAACCTTGGATGTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006099.3-1947s21c1
Sequence:CCGGGCTGTCGGTCAGACATCATTTCTCGAGAAATGATGTCTGACCGACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006099.3-880s21c1
Sequence:CCGGATCTGAGTTCGGACGGAATTACTCGAGTAATTCCGTCCGAACTCAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020784    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006099.2-2834s1c1
Sequence:CCGGCCCATAATAAAGGTTGTGAATCTCGAGATTCACAACCTTTATTATGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006099.2-128s1c1
Sequence:CCGGCCGGAACAAGAGTGGACGGAACTCGAGTTCCGTCCACTCTTGTTCCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006099.2-1618s1c1
Sequence:CCGGCCGACATCCAAGGTTTAGATTCTCGAGAATCTAAACCTTGGATGTCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006099.2-1903s1c1
Sequence:CCGGGCTGTCGGTCAGACATCATTTCTCGAGAAATGATGTCTGACCGACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006099.2-1167s1c1
Sequence:CCGGCCCTATGAATCTCTTATCATTCTCGAGAATGATAAGAGATTCATAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006099.3-1211s21c1
Sequence:CCGGCCCTATGAATCTCTTATCATTCTCGAGAATGATAAGAGATTCATAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006099
VALIDATED
PIAS3 MISSION shRNA Lentiviral Transduction Particles
protein inhibitor of activated STAT, 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000274273    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006099.3-2137s21c1
Sequence:CCGGCAGCACCCAAAGGGTTAATATCTCGAGATATTAACCCTTTGGGTGCTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006099.3-1662s21c1
Sequence:CCGGCCGACATCCAAGGTTTAGATTCTCGAGAATCTAAACCTTGGATGTCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006099.3-1947s21c1
Sequence:CCGGGCTGTCGGTCAGACATCATTTCTCGAGAAATGATGTCTGACCGACAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_006099.3-880s21c1
Sequence:CCGGATCTGAGTTCGGACGGAATTACTCGAGTAATTCCGTCCGAACTCAGATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020784    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006099.2-2834s1c1
Sequence:CCGGCCCATAATAAAGGTTGTGAATCTCGAGATTCACAACCTTTATTATGGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006099.2-128s1c1
Sequence:CCGGCCGGAACAAGAGTGGACGGAACTCGAGTTCCGTCCACTCTTGTTCCGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006099.2-1618s1c1
Sequence:CCGGCCGACATCCAAGGTTTAGATTCTCGAGAATCTAAACCTTGGATGTCGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006099.2-1903s1c1
Sequence:CCGGGCTGTCGGTCAGACATCATTTCTCGAGAAATGATGTCTGACCGACAGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006099.2-1167s1c1
Sequence:CCGGCCCTATGAATCTCTTATCATTCTCGAGAATGATAAGAGATTCATAGGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006099.3-1211s21c1
Sequence:CCGGCCCTATGAATCTCTTATCATTCTCGAGAATGATAAGAGATTCATAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)