EMAIL THIS PAGE TO A FRIEND

PIBF1

progesterone immunomodulatory binding factor 1

99 Gene Product Result for
Synonyms: C13orf24 CEP90 PIBF RP11-505F3.1
UniProtKB ID: Q8WXW3, O95664, Q6U9V2, Q6UG50, Q86V07, Q96SF4
Gene ID:
Mouse(52023) progesterone immunomodulatory binding factor 1
Rat(306104) progesterone immunomodulatory binding factor 1
Zebrafish(445181) progesterone immunomodulatory binding factor 1
chicken(418820) progesterone immunomodulatory binding factor 1
dog(476945) progesterone immunomodulatory binding factor 1
domestic cat(101082369) progesterone immunomodulatory binding factor 1
Horse(100065926) progesterone immunomodulatory binding factor 1
cow(524913) progesterone immunomodulatory binding factor 1
sheep(101123131) progesterone immunomodulatory binding factor 1
naked mole-rat(101722859) progesterone immunomodulatory binding factor 1
Domestic Rabbit(100341524) progesterone immunomodulatory binding factor 1
domestic guinea pig(100732239) progesterone immunomodulatory binding factor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029454 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029454 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029454 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006346 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006346 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006346 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006346 Rosetta Predictions human pricing
XM_001073989 Rosetta Predictions rat pricing
XM_224451 Rosetta Predictions rat pricing
NM_029320 Rosetta Predictions mouse pricing
NM_029454 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006346 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00230208 predicted 1222
2 SASI_Hs01_00230209 predicted 2357
3 SASI_Hs01_00230210 predicted 2410
4 SASI_Hs01_00230211 predicted 1482
5 SASI_Hs01_00230212 predicted 2306
6 SASI_Hs01_00230213 predicted 595
7 SASI_Hs02_00341382 predicted 359
8 SASI_Hs01_00230214 predicted 573
9 SASI_Hs02_00341383 predicted 2027
10 SASI_Hs01_00230216 predicted 2039
11 SASI_Hs01_00230215 predicted 868
12 SASI_Hs01_00230217 predicted 2377
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073989 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00344639 predicted 2266
2 SASI_Rn02_00344640 predicted 2279
3 SASI_Rn02_00344641 predicted 763
4 SASI_Rn02_00344642 predicted 749
5 SASI_Rn02_00344643 predicted 774
6 SASI_Rn02_00344644 predicted 1055
7 SASI_Rn02_00344645 predicted 263
8 SASI_Rn02_00344646 predicted 929
9 SASI_Rn02_00344647 predicted 1170
10 SASI_Rn02_00344648 predicted 992
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_224451 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00381988 predicted 305
2 SASI_Rn02_00381989 predicted 379
3 SASI_Rn02_00381990 predicted 252
4 SASI_Rn02_00381991 predicted 373
5 SASI_Rn02_00381992 predicted 267
6 SASI_Rn02_00381993 predicted 266
7 SASI_Rn02_00381994 predicted 513
8 SASI_Rn02_00381995 predicted 510
9 SASI_Rn02_00381996 predicted 2570
10 SASI_Rn02_00381997 predicted 510
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029320 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00335130 predicted 886
2 SASI_Mm02_00335131 predicted 1073
3 SASI_Mm02_00335132 predicted 1170
4 SASI_Mm01_00075946 predicted 1352
5 SASI_Mm02_00335133 predicted 1466
6 SASI_Mm02_00335134 predicted 1601
7 SASI_Mm01_00075947 predicted 1270
8 SASI_Mm02_00335135 predicted 1318
9 SASI_Mm01_00075950 predicted 1031
10 SASI_Mm01_00075952 predicted 1382
11 SASI_Mm01_00075943 predicted 2780
12 SASI_Mm01_00075944 predicted 2791
13 SASI_Mm01_00075945 predicted 2446
14 SASI_Mm01_00075948 predicted 2099
15 SASI_Mm01_00075949 predicted 2290
16 SASI_Mm01_00075951 predicted 2458
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029454 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00162827 predicted 880
2 SASI_Mm01_00162828 predicted 1077
3 SASI_Mm01_00162829 predicted 1167
4 SASI_Mm01_00162830 predicted 1358
5 SASI_Mm01_00162831 predicted 1467
6 SASI_Mm01_00162832 predicted 1607
7 SASI_Mm01_00162833 predicted 1270
8 SASI_Mm01_00162834 predicted 1323
9 SASI_Mm01_00162835 predicted 1034
10 SASI_Mm01_00162836 predicted 1387
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029454
PIBF1 MISSION shRNA Bacterial Glycerol Stock
progesterone immunomodulatory binding factor 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000249175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029454.4-1346s21c1
Sequence:CCGGGAAGAACTGAGTACAAGTAAACTCGAGTTTACTTGTACTCAGTTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249177    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029454.4-2537s21c1
Sequence:CCGGCACTAACAAAGAGCATATAATCTCGAGATTATATGCTCTTTGTTAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215928    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029454.4-2537s1c1
Sequence:CCGGCACTAACAAAGAGCATATAATCTCGAGATTATATGCTCTTTGTTAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029454.4-1282s21c1
Sequence:CCGGTGAGCTCGTGAACCCATTAAGCTCGAGCTTAATGGGTTCACGAGCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029454.4-1034s21c1
Sequence:CCGGTTAGACAATCAGTTGACTATTCTCGAGAATAGTCAACTGATTGTCTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029454.4-1807s21c1
Sequence:CCGGCACGTCCAGAGACCATTATAACTCGAGTTATAATGGTCTCTGGACGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029454.3-1018s1c1
Sequence:CCGGGCTGCTAACTTTGCGATTAGACTCGAGTCTAATCGCAAAGTTAGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029454.3-1598s1c1
Sequence:CCGGGCTCAAGCTAAGGAAAGGAATCTCGAGATTCCTTTCCTTAGCTTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029454.3-1421s1c1
Sequence:CCGGGAACTTCTAATTCGATGTCAACTCGAGTTGACATCGAATTAGAAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029454.4-773s1c1
Sequence:CCGGGAGTCTGAAGATATTAGTTTGCTCGAGCAAACTAATATCTTCAGACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029454
PIBF1 MISSION shRNA shRNA Plasmid DNA
progesterone immunomodulatory binding factor 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000249175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029454.4-1346s21c1
Sequence:CCGGGAAGAACTGAGTACAAGTAAACTCGAGTTTACTTGTACTCAGTTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249177    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029454.4-2537s21c1
Sequence:CCGGCACTAACAAAGAGCATATAATCTCGAGATTATATGCTCTTTGTTAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215928    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029454.4-2537s1c1
Sequence:CCGGCACTAACAAAGAGCATATAATCTCGAGATTATATGCTCTTTGTTAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029454.4-1282s21c1
Sequence:CCGGTGAGCTCGTGAACCCATTAAGCTCGAGCTTAATGGGTTCACGAGCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029454.4-1034s21c1
Sequence:CCGGTTAGACAATCAGTTGACTATTCTCGAGAATAGTCAACTGATTGTCTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029454.4-1807s21c1
Sequence:CCGGCACGTCCAGAGACCATTATAACTCGAGTTATAATGGTCTCTGGACGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029454.3-1018s1c1
Sequence:CCGGGCTGCTAACTTTGCGATTAGACTCGAGTCTAATCGCAAAGTTAGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029454.3-1598s1c1
Sequence:CCGGGCTCAAGCTAAGGAAAGGAATCTCGAGATTCCTTTCCTTAGCTTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029454.3-1421s1c1
Sequence:CCGGGAACTTCTAATTCGATGTCAACTCGAGTTGACATCGAATTAGAAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029454.4-773s1c1
Sequence:CCGGGAGTCTGAAGATATTAGTTTGCTCGAGCAAACTAATATCTTCAGACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029454
PIBF1 MISSION shRNA Lentiviral Transduction Particles
progesterone immunomodulatory binding factor 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000249175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029454.4-1346s21c1
Sequence:CCGGGAAGAACTGAGTACAAGTAAACTCGAGTTTACTTGTACTCAGTTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249177    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029454.4-2537s21c1
Sequence:CCGGCACTAACAAAGAGCATATAATCTCGAGATTATATGCTCTTTGTTAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215928    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029454.4-2537s1c1
Sequence:CCGGCACTAACAAAGAGCATATAATCTCGAGATTATATGCTCTTTGTTAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029454.4-1282s21c1
Sequence:CCGGTGAGCTCGTGAACCCATTAAGCTCGAGCTTAATGGGTTCACGAGCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029454.4-1034s21c1
Sequence:CCGGTTAGACAATCAGTTGACTATTCTCGAGAATAGTCAACTGATTGTCTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029454.4-1807s21c1
Sequence:CCGGCACGTCCAGAGACCATTATAACTCGAGTTATAATGGTCTCTGGACGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029454.3-1018s1c1
Sequence:CCGGGCTGCTAACTTTGCGATTAGACTCGAGTCTAATCGCAAAGTTAGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029454.3-1598s1c1
Sequence:CCGGGCTCAAGCTAAGGAAAGGAATCTCGAGATTCCTTTCCTTAGCTTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029454.3-1421s1c1
Sequence:CCGGGAACTTCTAATTCGATGTCAACTCGAGTTGACATCGAATTAGAAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029454.4-773s1c1
Sequence:CCGGGAGTCTGAAGATATTAGTTTGCTCGAGCAAACTAATATCTTCAGACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006346
VALIDATED
PIBF1 MISSION shRNA Bacterial Glycerol Stock
progesterone immunomodulatory binding factor 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006346.1-556s1c1
Sequence:CCGGCGCTTCTATGAGCTAGTGAATCTCGAGATTCACTAGCTCATAGAAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006346.1-1841s1c1
Sequence:CCGGCAGAGGCCAATTCGCTATTAACTCGAGTTAATAGCGAATTGGCCTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006346.2-1394s21c1
Sequence:CCGGAGCATCCAGAGACCATTATAACTCGAGTTATAATGGTCTCTGGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006346.2-2379s21c1
Sequence:CCGGCTCGTTAAGATGCATAGTAAACTCGAGTTTACTATGCATCTTAACGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006346.1-869s1c1
Sequence:CCGGCCTCTCACATGATTCAAACAACTCGAGTTGTTTGAATCATGTGAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006346.2-516s21c1
Sequence:CCGGACTATGATGATCGACAATTTGCTCGAGCAAATTGTCGATCATCATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244187    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006346.2-2594s21c1
Sequence:CCGGAGCACCTGTAGACCATTATATCTCGAGATATAATGGTCTACAGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006346.2-868s21c1
Sequence:CCGGATGAGCTAGTGAATCCATTAACTCGAGTTAATGGATTCACTAGCTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006346
VALIDATED
PIBF1 MISSION shRNA shRNA Plasmid DNA
progesterone immunomodulatory binding factor 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006346.1-556s1c1
Sequence:CCGGCGCTTCTATGAGCTAGTGAATCTCGAGATTCACTAGCTCATAGAAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006346.1-1841s1c1
Sequence:CCGGCAGAGGCCAATTCGCTATTAACTCGAGTTAATAGCGAATTGGCCTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006346.2-1394s21c1
Sequence:CCGGAGCATCCAGAGACCATTATAACTCGAGTTATAATGGTCTCTGGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006346.2-2379s21c1
Sequence:CCGGCTCGTTAAGATGCATAGTAAACTCGAGTTTACTATGCATCTTAACGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006346.1-869s1c1
Sequence:CCGGCCTCTCACATGATTCAAACAACTCGAGTTGTTTGAATCATGTGAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006346.2-516s21c1
Sequence:CCGGACTATGATGATCGACAATTTGCTCGAGCAAATTGTCGATCATCATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244187    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006346.2-2594s21c1
Sequence:CCGGAGCACCTGTAGACCATTATATCTCGAGATATAATGGTCTACAGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006346.2-868s21c1
Sequence:CCGGATGAGCTAGTGAATCCATTAACTCGAGTTAATGGATTCACTAGCTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006346
VALIDATED
PIBF1 MISSION shRNA Lentiviral Transduction Particles
progesterone immunomodulatory binding factor 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006346.1-556s1c1
Sequence:CCGGCGCTTCTATGAGCTAGTGAATCTCGAGATTCACTAGCTCATAGAAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006346.1-1841s1c1
Sequence:CCGGCAGAGGCCAATTCGCTATTAACTCGAGTTAATAGCGAATTGGCCTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006346.2-1394s21c1
Sequence:CCGGAGCATCCAGAGACCATTATAACTCGAGTTATAATGGTCTCTGGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006346.2-2379s21c1
Sequence:CCGGCTCGTTAAGATGCATAGTAAACTCGAGTTTACTATGCATCTTAACGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006346.1-869s1c1
Sequence:CCGGCCTCTCACATGATTCAAACAACTCGAGTTGTTTGAATCATGTGAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006346.2-516s21c1
Sequence:CCGGACTATGATGATCGACAATTTGCTCGAGCAAATTGTCGATCATCATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244187    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006346.2-2594s21c1
Sequence:CCGGAGCACCTGTAGACCATTATATCTCGAGATATAATGGTCTACAGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006346.2-868s21c1
Sequence:CCGGATGAGCTAGTGAATCCATTAACTCGAGTTAATGGATTCACTAGCTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)