EMAIL THIS PAGE TO A FRIEND

PICALM

phosphatidylinositol binding clathrin assembly protein

179 Gene Product Result for
Synonyms: CALM CLTH LAP
Gene ID:
Human(8301) Summary: This gene encodes a clathrin assembly protein, which recruits clathrin and adaptor protein complex 2 (AP2) to cell membranes at sites of coated-pit formation and clathrin-vesicle assembly. The protein may be required to determine the amount of membrane to be recycled, possibly by regulating the size of the clathrin cage. The protein is involved in AP2-dependent clathrin-mediated endocytosis at the neuromuscular junction. A chromosomal translocation t(10;11)(p13;q14) leading to the fusion of this gene and the MLLT10 gene is found in acute lymphoblastic leukemia, acute myeloid leukemia and malignant lymphomas. The polymorphisms of this gene are associated with the risk of Alzheimer disease. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2011]
Mouse(233489) phosphatidylinositol binding clathrin assembly protein
Rat(89816) phosphatidylinositol binding clathrin assembly protein
chicken(425991) phosphatidylinositol binding clathrin assembly protein
dog(476780) phosphatidylinositol binding clathrin assembly protein
Horse(100050701) phosphatidylinositol binding clathrin assembly protein
domestic cat(101094948) phosphatidylinositol binding clathrin assembly protein
domestic guinea pig(100729067) phosphatidylinositol binding clathrin assembly protein
naked mole-rat(101706016) phosphatidylinositol binding clathrin assembly protein
cow(513579) phosphatidylinositol binding clathrin assembly protein
sheep(101103193) phosphatidylinositol binding clathrin assembly protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007166 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007166 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007166 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_146194 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146194 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146194 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008660 Rosetta Predictions human pricing
NM_007166 Rosetta Predictions human pricing
NM_053554 Rosetta Predictions rat pricing
NM_146194 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008660 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00156952 predicted 451
2 SASI_Hs01_00156953 predicted 1216
3 SASI_Hs01_00156954 predicted 925
4 SASI_Hs01_00156955 predicted 504
5 SASI_Hs01_00156956 predicted 829
6 SASI_Hs01_00156957 predicted 421
7 SASI_Hs01_00156958 predicted 1005
8 SASI_Hs02_00305518 predicted 1060
9 SASI_Hs01_00156959 predicted 885
10 SASI_Hs01_00156960 predicted 1276
11 SASI_Hs01_00156951 predicted 2198
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007166 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00226511 predicted 448
2 SASI_Hs01_00226512 predicted 1215
3 SASI_Hs01_00226513 predicted 925
4 SASI_Hs01_00226514 predicted 505
5 SASI_Hs01_00226515 predicted 825
6 SASI_Hs01_00226516 predicted 419
7 SASI_Hs01_00226517 predicted 1005
8 SASI_Hs02_00343098 predicted 1066
9 SASI_Hs01_00226518 predicted 877
10 SASI_Hs01_00226519 predicted 1280
11 SASI_Hs01_00226510 predicted 2317
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053554 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00094752 predicted 1184
2 SASI_Rn01_00094754 predicted 431
3 SASI_Rn02_00266208 predicted 479
4 SASI_Rn01_00094755 predicted 619
5 SASI_Rn01_00094757 predicted 1695
6 SASI_Rn01_00094758 predicted 1651
7 SASI_Rn01_00094759 predicted 227
8 SASI_Rn02_00266209 predicted 1338
9 SASI_Rn02_00266210 predicted 309
10 SASI_Rn02_00266211 predicted 1179
11 SASI_Rn01_00094753 predicted 290
12 SASI_Rn01_00094756 predicted 1425
13 SASI_Rn01_00094760 predicted 813
14 SASI_Rn01_00094761 predicted 407
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146194 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00027453 predicted 540
2 SASI_Mm01_00027454 predicted 753
3 SASI_Mm01_00027455 predicted 2112
4 SASI_Mm01_00027456 predicted 2332
5 SASI_Mm01_00027457 predicted 2009
6 SASI_Mm02_00341890 predicted 2418
7 SASI_Mm01_00027458 predicted 798
8 SASI_Mm01_00027459 predicted 1122
9 SASI_Mm01_00027460 predicted 1509
10 SASI_Mm01_00027461 predicted 1496
11 SASI_Mm01_00027462 predicted 636
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007166
VALIDATED
PICALM MISSION shRNA Bacterial Glycerol Stock
phosphatidylinositol binding clathrin assembly protein
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000230157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007166.2-1931s21c1
Sequence:CCGGGGCAATCTTGGCATCGGAAATCTCGAGATTTCCGATGCCAAGATTGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007166.1-1987s1c1
Sequence:CCGGCCTCCACAAATGGGAAGTGTTCTCGAGAACACTTCCCATTTGTGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_007166.1-210s1c1
Sequence:CCGGCGTATCCAAGACAGTATGCAACTCGAGTTGCATACTGTCTTGGATACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007166.1-509s1c1
Sequence:CCGGCTACATTTATTAGGCGGTATACTCGAGTATACCGCCTAATAAATGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_007166.1-1741s1c1
Sequence:CCGGCCTAGCAAGTTAGTATCTGATCTCGAGATCAGATACTAACTTGCTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A3
TRC Version: 1 Clone ID:NM_007166.1-1598s1c1
Sequence:CCGGGCCTTAATGTTGACTTTGAATCTCGAGATTCAAAGTCAACATTAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218840    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007166.2-3302s21c1
Sequence:GTACCGGTGCCATGTTATGATCATATACCTCGAGGTATATGATCATAACATGGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007166.2-2154s21c1
Sequence:CCGGTGACGCAACCAACCTTAATATCTCGAGATATTAAGGTTGGTTGCGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007166.2-1397s21c1
Sequence:CCGGGCACCAGCCATTGACATATTTCTCGAGAAATATGTCAATGGCTGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007166.2-1059s21c1
Sequence:CCGGGAATTGACAGAGGTGATATACCTCGAGGTATATCACCTCTGTCAATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007166
VALIDATED
PICALM MISSION shRNA shRNA Plasmid DNA
phosphatidylinositol binding clathrin assembly protein
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000230157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007166.2-1931s21c1
Sequence:CCGGGGCAATCTTGGCATCGGAAATCTCGAGATTTCCGATGCCAAGATTGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007166.1-1987s1c1
Sequence:CCGGCCTCCACAAATGGGAAGTGTTCTCGAGAACACTTCCCATTTGTGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_007166.1-210s1c1
Sequence:CCGGCGTATCCAAGACAGTATGCAACTCGAGTTGCATACTGTCTTGGATACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007166.1-509s1c1
Sequence:CCGGCTACATTTATTAGGCGGTATACTCGAGTATACCGCCTAATAAATGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_007166.1-1741s1c1
Sequence:CCGGCCTAGCAAGTTAGTATCTGATCTCGAGATCAGATACTAACTTGCTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A3
TRC Version: 1 Clone ID:NM_007166.1-1598s1c1
Sequence:CCGGGCCTTAATGTTGACTTTGAATCTCGAGATTCAAAGTCAACATTAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218840    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007166.2-3302s21c1
Sequence:GTACCGGTGCCATGTTATGATCATATACCTCGAGGTATATGATCATAACATGGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007166.2-2154s21c1
Sequence:CCGGTGACGCAACCAACCTTAATATCTCGAGATATTAAGGTTGGTTGCGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007166.2-1397s21c1
Sequence:CCGGGCACCAGCCATTGACATATTTCTCGAGAAATATGTCAATGGCTGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007166.2-1059s21c1
Sequence:CCGGGAATTGACAGAGGTGATATACCTCGAGGTATATCACCTCTGTCAATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007166
VALIDATED
PICALM MISSION shRNA Lentiviral Transduction Particles
phosphatidylinositol binding clathrin assembly protein
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000230157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007166.2-1931s21c1
Sequence:CCGGGGCAATCTTGGCATCGGAAATCTCGAGATTTCCGATGCCAAGATTGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007166.1-1987s1c1
Sequence:CCGGCCTCCACAAATGGGAAGTGTTCTCGAGAACACTTCCCATTTGTGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_007166.1-210s1c1
Sequence:CCGGCGTATCCAAGACAGTATGCAACTCGAGTTGCATACTGTCTTGGATACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007166.1-509s1c1
Sequence:CCGGCTACATTTATTAGGCGGTATACTCGAGTATACCGCCTAATAAATGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_007166.1-1741s1c1
Sequence:CCGGCCTAGCAAGTTAGTATCTGATCTCGAGATCAGATACTAACTTGCTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A3
TRC Version: 1 Clone ID:NM_007166.1-1598s1c1
Sequence:CCGGGCCTTAATGTTGACTTTGAATCTCGAGATTCAAAGTCAACATTAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218840    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007166.2-3302s21c1
Sequence:GTACCGGTGCCATGTTATGATCATATACCTCGAGGTATATGATCATAACATGGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007166.2-2154s21c1
Sequence:CCGGTGACGCAACCAACCTTAATATCTCGAGATATTAAGGTTGGTTGCGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007166.2-1397s21c1
Sequence:CCGGGCACCAGCCATTGACATATTTCTCGAGAAATATGTCAATGGCTGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007166.2-1059s21c1
Sequence:CCGGGAATTGACAGAGGTGATATACCTCGAGGTATATCACCTCTGTCAATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146194
VALIDATED
PICALM MISSION shRNA Bacterial Glycerol Stock
phosphatidylinositol binding clathrin assembly protein
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000113185    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_146194.2-2487s1c1
Sequence:CCGGGCGTTGTCAATACCACTTATACTCGAGTATAAGTGGTATTGACAACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146194.2-2182s1c1
Sequence:CCGGCGGGCATGATAGGATATGGAACTCGAGTTCCATATCCTATCATGCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_146194.2-2011s1c1
Sequence:CCGGCCACTAAGAATGATGTAAGTTCTCGAGAACTTACATCATTCTTAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_146194.2-633s1c1
Sequence:CCGGGCTTCAAGAAACACATTGTTTCTCGAGAAACAATGTGTTTCTTGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_146194.2-966s1c1
Sequence:CCGGGCAGCATACAATGAAGGAATTCTCGAGAATTCCTTCATTGTATGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146194.3-575s21c1
Sequence:GTACCGGACTCATTACAACTCATCATTTCTCGAGAAATGATGAGTTGTAATGAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146194.3-1924s21c1
Sequence:GTACCGGCCAAACTTCCGCCTAACAAATCTCGAGATTTGTTAGGCGGAAGTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146194.3-1352s21c1
Sequence:GTACCGGATTAAAGGAACAGCGTCTAAACTCGAGTTTAGACGCTGTTCCTTTAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_146194.3-715s21c1
Sequence:CCGGGACGGTATAGTAGATACTTAACTCGAGTTAAGTATCTACTATACCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_146194.3-680s21c1
Sequence:CCGGTGGATTGCAAGGATATGATATCTCGAGATATCATATCCTTGCAATCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312362    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_146194.3-2487s21c1
Sequence:CCGGGCGTTGTCAATACCACTTATACTCGAGTATAAGTGGTATTGACAACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_146194.3-633s21c1
Sequence:CCGGGCTTCAAGAAACACATTGTTTCTCGAGAAACAATGTGTTTCTTGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146194.3-1452s21c1
Sequence:CCGGGCACCAGCCATTGACATATTTCTCGAGAAATATGTCAATGGCTGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146194
VALIDATED
PICALM MISSION shRNA shRNA Plasmid DNA
phosphatidylinositol binding clathrin assembly protein
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000113185    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_146194.2-2487s1c1
Sequence:CCGGGCGTTGTCAATACCACTTATACTCGAGTATAAGTGGTATTGACAACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146194.2-2182s1c1
Sequence:CCGGCGGGCATGATAGGATATGGAACTCGAGTTCCATATCCTATCATGCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_146194.2-2011s1c1
Sequence:CCGGCCACTAAGAATGATGTAAGTTCTCGAGAACTTACATCATTCTTAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_146194.2-633s1c1
Sequence:CCGGGCTTCAAGAAACACATTGTTTCTCGAGAAACAATGTGTTTCTTGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_146194.2-966s1c1
Sequence:CCGGGCAGCATACAATGAAGGAATTCTCGAGAATTCCTTCATTGTATGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146194.3-575s21c1
Sequence:GTACCGGACTCATTACAACTCATCATTTCTCGAGAAATGATGAGTTGTAATGAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146194.3-1924s21c1
Sequence:GTACCGGCCAAACTTCCGCCTAACAAATCTCGAGATTTGTTAGGCGGAAGTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146194.3-1352s21c1
Sequence:GTACCGGATTAAAGGAACAGCGTCTAAACTCGAGTTTAGACGCTGTTCCTTTAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_146194.3-715s21c1
Sequence:CCGGGACGGTATAGTAGATACTTAACTCGAGTTAAGTATCTACTATACCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_146194.3-680s21c1
Sequence:CCGGTGGATTGCAAGGATATGATATCTCGAGATATCATATCCTTGCAATCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312362    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_146194.3-2487s21c1
Sequence:CCGGGCGTTGTCAATACCACTTATACTCGAGTATAAGTGGTATTGACAACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_146194.3-633s21c1
Sequence:CCGGGCTTCAAGAAACACATTGTTTCTCGAGAAACAATGTGTTTCTTGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146194.3-1452s21c1
Sequence:CCGGGCACCAGCCATTGACATATTTCTCGAGAAATATGTCAATGGCTGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146194
VALIDATED
PICALM MISSION shRNA Lentiviral Transduction Particles
phosphatidylinositol binding clathrin assembly protein
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000113185    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_146194.2-2487s1c1
Sequence:CCGGGCGTTGTCAATACCACTTATACTCGAGTATAAGTGGTATTGACAACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146194.2-2182s1c1
Sequence:CCGGCGGGCATGATAGGATATGGAACTCGAGTTCCATATCCTATCATGCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_146194.2-2011s1c1
Sequence:CCGGCCACTAAGAATGATGTAAGTTCTCGAGAACTTACATCATTCTTAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_146194.2-633s1c1
Sequence:CCGGGCTTCAAGAAACACATTGTTTCTCGAGAAACAATGTGTTTCTTGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_146194.2-966s1c1
Sequence:CCGGGCAGCATACAATGAAGGAATTCTCGAGAATTCCTTCATTGTATGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146194.3-575s21c1
Sequence:GTACCGGACTCATTACAACTCATCATTTCTCGAGAAATGATGAGTTGTAATGAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146194.3-1924s21c1
Sequence:GTACCGGCCAAACTTCCGCCTAACAAATCTCGAGATTTGTTAGGCGGAAGTTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146194.3-1352s21c1
Sequence:GTACCGGATTAAAGGAACAGCGTCTAAACTCGAGTTTAGACGCTGTTCCTTTAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_146194.3-715s21c1
Sequence:CCGGGACGGTATAGTAGATACTTAACTCGAGTTAAGTATCTACTATACCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_146194.3-680s21c1
Sequence:CCGGTGGATTGCAAGGATATGATATCTCGAGATATCATATCCTTGCAATCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312362    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_146194.3-2487s21c1
Sequence:CCGGGCGTTGTCAATACCACTTATACTCGAGTATAAGTGGTATTGACAACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_146194.3-633s21c1
Sequence:CCGGGCTTCAAGAAACACATTGTTTCTCGAGAAACAATGTGTTTCTTGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146194.3-1452s21c1
Sequence:CCGGGCACCAGCCATTGACATATTTCTCGAGAAATATGTCAATGGCTGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)