EMAIL THIS PAGE TO A FRIEND

PICK1

protein interacting with PRKCA 1

107 Gene Product Result for
Synonyms: PICK PRKCABP
UniProtKB ID: Q9NRD5, O95906
Gene ID:
Human(9463) Summary: The protein encoded by this gene contains a PDZ domain, through which it interacts with protein kinase C, alpha (PRKCA). This protein may function as an adaptor that binds to and organizes the subcellular localization of a variety of membrane proteins. It has been shown to interact with multiple glutamate receptor subtypes, monoamine plasma membrane transporters, as well as non-voltage gated sodium channels, and may target PRKCA to these membrane proteins and thus regulate their distribution and function. This protein has also been found to act as an anchoring protein that specifically targets PRKCA to mitochondria in a ligand-specific manner. Three transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(18693) protein interacting with C kinase 1
Rat(84591) protein interacting with PRKCA 1
fruit fly(34677) CG6167 gene product from transcript CG6167-RA
chicken(418030) protein interacting with PRKCA 1
domestic cat(101100492) protein interacting with PRKCA 1
Horse(100055023) protein interacting with PRKCA 1
dog(610191) protein interacting with PRKCA 1
cow(533737) protein interacting with PRKCA 1
sheep(101120406) protein interacting with PRKCA 1
naked mole-rat(101711886) protein interacting with PRKCA 1
domestic guinea pig(100726480) protein interacting with PRKCA 1
Gene Class: ATPase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012407 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012407 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012407 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008837 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008837 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008837 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU066021 MISSION® esiRNA targeting human PICK1 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039583 Rosetta Predictions human pricing
NM_001039584 Rosetta Predictions human pricing
NM_012407 Rosetta Predictions human pricing
NM_053460 Rosetta Predictions rat pricing
NM_001045558 Rosetta Predictions mouse pricing
NM_008837 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039583 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00086880 predicted 487
2 SASI_Hs02_00308586 predicted 1024
3 SASI_Hs01_00086881 predicted 498
4 SASI_Hs02_00308587 predicted 1095
5 SASI_Hs01_00086882 predicted 1042
6 SASI_Hs01_00086883 predicted 1072
7 SASI_Hs01_00086886 predicted 1088
8 SASI_Hs01_00086888 predicted 504
9 SASI_Hs01_00086889 predicted 941
10 SASI_Hs02_00308588 predicted 782
11 SASI_Hs01_00086884 predicted 627
12 SASI_Hs01_00086885 predicted 1841
13 SASI_Hs01_00086887 predicted 1879
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039584 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00196541 predicted 429
2 SASI_Hs02_00308589 predicted 967
3 SASI_Hs01_00196542 predicted 450
4 SASI_Hs02_00308590 predicted 1035
5 SASI_Hs01_00196543 predicted 993
6 SASI_Hs01_00196544 predicted 1020
7 SASI_Hs01_00196547 predicted 1034
8 SASI_Hs01_00196549 predicted 446
9 SASI_Hs01_00196550 predicted 888
10 SASI_Hs02_00308591 predicted 727
11 SASI_Hs01_00196545 predicted 583
12 SASI_Hs01_00196546 predicted 1792
13 SASI_Hs01_00196548 predicted 1817
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012407 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00067058 predicted 585
2 SASI_Hs02_00344252 predicted 1117
3 SASI_Hs01_00067059 predicted 600
4 SASI_Hs02_00344253 predicted 1187
5 SASI_Hs01_00067060 predicted 1141
6 SASI_Hs01_00067061 predicted 1168
7 SASI_Hs01_00067064 predicted 1190
8 SASI_Hs01_00067066 predicted 600
9 SASI_Hs01_00067067 predicted 1035
10 SASI_Hs02_00344254 predicted 879
11 SASI_Hs01_00067062 predicted 726
12 SASI_Hs01_00067063 predicted 1941
13 SASI_Hs01_00067065 predicted 1968
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053460 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00086169 predicted 440
2 SASI_Rn01_00086170 predicted 501
3 SASI_Rn01_00086171 predicted 321
4 SASI_Rn01_00086172 predicted 678
5 SASI_Rn01_00086173 predicted 724
6 SASI_Rn01_00086174 predicted 853
7 SASI_Rn02_00266041 predicted 409
8 SASI_Rn01_00086175 predicted 402
9 SASI_Rn01_00086176 predicted 903
10 SASI_Rn01_00086177 predicted 756
11 SASI_Rn01_00086168 predicted 477
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001045558 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00291811 predicted 849
2 SASI_Mm02_00291812 predicted 609
3 SASI_Mm02_00291813 predicted 675
4 SASI_Mm02_00291814 predicted 492
5 SASI_Mm02_00291815 predicted 901
6 SASI_Mm02_00291816 predicted 389
7 SASI_Mm02_00291817 predicted 576
8 SASI_Mm02_00291818 predicted 1274
9 SASI_Mm02_00291819 predicted 895
10 SASI_Mm02_00291820 predicted 1069
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008837 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00153019 predicted 913
2 SASI_Mm01_00153020 predicted 669
3 SASI_Mm01_00153021 predicted 736
4 SASI_Mm01_00153022 predicted 550
5 SASI_Mm01_00153023 predicted 957
6 SASI_Mm02_00314773 predicted 444
7 SASI_Mm01_00153025 predicted 641
8 SASI_Mm01_00153026 predicted 1334
9 SASI_Mm01_00153027 predicted 952
10 SASI_Mm02_00314774 predicted 1127
11 SASI_Mm01_00153024 predicted 339
12 SASI_Mm01_00153028 predicted 220
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012407
VALIDATED
PICK1 MISSION shRNA Bacterial Glycerol Stock
protein interacting with PRKCA 1
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000446377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012407.3-775s21c1
Sequence:CCGGATGAGTTCAGGGACCGCAGATCTCGAGATCTGCGGTCCCTGAACTCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012407.3-822s21c1
Sequence:CCGGGTGCAATGATGGGCTTGTCAACTCGAGTTGACAAGCCCATCATTGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349739    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012407.3-1889s21c1
Sequence:CCGGTTGGTCTCTGGACCTGCCTTACTCGAGTAAGGCAGGTCCAGAGACCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012407.3-1037s1c1
Sequence:CCGGGCATCGAGAAGTTCGGCATTCCTCGAGGAATGCCGAACTTCTCGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012407.3-417s21c1
Sequence:CCGGCGAAGAGGATAAACTCGGAATCTCGAGATTCCGAGTTTATCCTCTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012407.3-1093s21c1
Sequence:CCGGCTGAACACGTACCTCAACAAACTCGAGTTTGTTGAGGTACGTGTTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000446182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012407.3-1126s21c1
Sequence:CCGGACTCGCCTCACCATCAAGAAGCTCGAGCTTCTTGATGGTGAGGCGAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012407.1-364s1c1
Sequence:CCGGGCCTCTATATCGTCCAGGTATCTCGAGATACCTGGACGATATAGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_012407.1-986s1c1
Sequence:CCGGCCTGGACGTGAAGTTTGAGTACTCGAGTACTCAAACTTCACGTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_012407.1-930s1c1
Sequence:CCGGCTGAACACGTACCTCAACAAACTCGAGTTTGTTGAGGTACGTGTTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012407.1-704s1c1
Sequence:CCGGCGCTGAGCTATACAAAGGGATCTCGAGATCCCTTTGTATAGCTCAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_012407.1-254s1c1
Sequence:CCGGCGAAGAGGATAAACTCGGAATCTCGAGATTCCGAGTTTATCCTCTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012407.3-593s21c1
Sequence:CCGGATGAGATCACCGGTGTCAATGCTCGAGCATTGACACCGGTGATCTCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012407
VALIDATED
PICK1 MISSION shRNA shRNA Plasmid DNA
protein interacting with PRKCA 1
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000446377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012407.3-775s21c1
Sequence:CCGGATGAGTTCAGGGACCGCAGATCTCGAGATCTGCGGTCCCTGAACTCATTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000414836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012407.3-822s21c1
Sequence:CCGGGTGCAATGATGGGCTTGTCAACTCGAGTTGACAAGCCCATCATTGCACTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000349739    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012407.3-1889s21c1
Sequence:CCGGTTGGTCTCTGGACCTGCCTTACTCGAGTAAGGCAGGTCCAGAGACCAATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000199536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012407.3-1037s1c1
Sequence:CCGGGCATCGAGAAGTTCGGCATTCCTCGAGGAATGCCGAACTTCTCGATGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000327697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012407.3-417s21c1
Sequence:CCGGCGAAGAGGATAAACTCGGAATCTCGAGATTCCGAGTTTATCCTCTTCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000327775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012407.3-1093s21c1
Sequence:CCGGCTGAACACGTACCTCAACAAACTCGAGTTTGTTGAGGTACGTGTTCAGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000446182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012407.3-1126s21c1
Sequence:CCGGACTCGCCTCACCATCAAGAAGCTCGAGCTTCTTGATGGTGAGGCGAGTTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000037904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012407.1-364s1c1
Sequence:CCGGGCCTCTATATCGTCCAGGTATCTCGAGATACCTGGACGATATAGAGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000037908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_012407.1-986s1c1
Sequence:CCGGCCTGGACGTGAAGTTTGAGTACTCGAGTACTCAAACTTCACGTCCAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000037907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_012407.1-930s1c1
Sequence:CCGGCTGAACACGTACCTCAACAAACTCGAGTTTGTTGAGGTACGTGTTCAGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000037906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012407.1-704s1c1
Sequence:CCGGCGCTGAGCTATACAAAGGGATCTCGAGATCCCTTTGTATAGCTCAGCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000037905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_012407.1-254s1c1
Sequence:CCGGCGAAGAGGATAAACTCGGAATCTCGAGATTCCGAGTTTATCCTCTTCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000426501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012407.3-593s21c1
Sequence:CCGGATGAGATCACCGGTGTCAATGCTCGAGCATTGACACCGGTGATCTCATTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012407
VALIDATED
PICK1 MISSION shRNA Lentiviral Transduction Particles
protein interacting with PRKCA 1
Human
13 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000446377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012407.3-775s21c1
Sequence:CCGGATGAGTTCAGGGACCGCAGATCTCGAGATCTGCGGTCCCTGAACTCATTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012407.3-822s21c1
Sequence:CCGGGTGCAATGATGGGCTTGTCAACTCGAGTTGACAAGCCCATCATTGCACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349739    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012407.3-1889s21c1
Sequence:CCGGTTGGTCTCTGGACCTGCCTTACTCGAGTAAGGCAGGTCCAGAGACCAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012407.3-1037s1c1
Sequence:CCGGGCATCGAGAAGTTCGGCATTCCTCGAGGAATGCCGAACTTCTCGATGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012407.3-417s21c1
Sequence:CCGGCGAAGAGGATAAACTCGGAATCTCGAGATTCCGAGTTTATCCTCTTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012407.3-1093s21c1
Sequence:CCGGCTGAACACGTACCTCAACAAACTCGAGTTTGTTGAGGTACGTGTTCAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000446182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012407.3-1126s21c1
Sequence:CCGGACTCGCCTCACCATCAAGAAGCTCGAGCTTCTTGATGGTGAGGCGAGTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012407.1-364s1c1
Sequence:CCGGGCCTCTATATCGTCCAGGTATCTCGAGATACCTGGACGATATAGAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_012407.1-986s1c1
Sequence:CCGGCCTGGACGTGAAGTTTGAGTACTCGAGTACTCAAACTTCACGTCCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_012407.1-930s1c1
Sequence:CCGGCTGAACACGTACCTCAACAAACTCGAGTTTGTTGAGGTACGTGTTCAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012407.1-704s1c1
Sequence:CCGGCGCTGAGCTATACAAAGGGATCTCGAGATCCCTTTGTATAGCTCAGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_012407.1-254s1c1
Sequence:CCGGCGAAGAGGATAAACTCGGAATCTCGAGATTCCGAGTTTATCCTCTTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012407.3-593s21c1
Sequence:CCGGATGAGATCACCGGTGTCAATGCTCGAGCATTGACACCGGTGATCTCATTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008837
VALIDATED
PICK1 MISSION shRNA Bacterial Glycerol Stock
protein interacting with PRKCA 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000368719    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008837.2-1643s21c1
Sequence:CCGGAGGCATATAGTGGCGCATAAACTCGAGTTTATGCGCCACTATATGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008837.2-450s21c1
Sequence:CCGGTCTATATCGTCCAGGTATTTGCTCGAGCAAATACCTGGACGATATAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361337    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008837.2-1693s21c1
Sequence:CCGGTGCTCCTCTGTCCTCAAACAGCTCGAGCTGTTTGAGGACAGAGGAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008837.2-1328s21c1
Sequence:CCGGACCATGTCCAAGTACTATAATCTCGAGATTATAGTACTTGGACATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008837.2-1167s21c1
Sequence:CCGGGAGTGAGCACAGGCAACTATGCTCGAGCATAGTTGCCTGTGCTCACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088598    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008837.1-1331s1c1
Sequence:CCGGGAAGGCATATAGTGGCGCATACTCGAGTATGCGCCACTATATGCCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008837.1-27s1c1
Sequence:CCGGCGAAGAGGATAAATTAGGAATCTCGAGATTCCTAATTTATCCTCTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008837.1-338s1c1
Sequence:CCGGCCCTGGACATTGTGTTGAAGACTCGAGTCTTCAACACAATGTCCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008837.1-340s1c1
Sequence:CCGGCTGGACATTGTGTTGAAGAAACTCGAGTTTCTTCAACACAATGTCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008837.1-702s1c1
Sequence:CCGGCCTGAACACGTACCTCAATAACTCGAGTTATTGAGGTACGTGTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008837
VALIDATED
PICK1 MISSION shRNA shRNA Plasmid DNA
protein interacting with PRKCA 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000368719    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008837.2-1643s21c1
Sequence:CCGGAGGCATATAGTGGCGCATAAACTCGAGTTTATGCGCCACTATATGCCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000361335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008837.2-450s21c1
Sequence:CCGGTCTATATCGTCCAGGTATTTGCTCGAGCAAATACCTGGACGATATAGATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000361337    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008837.2-1693s21c1
Sequence:CCGGTGCTCCTCTGTCCTCAAACAGCTCGAGCTGTTTGAGGACAGAGGAGCATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000361336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008837.2-1328s21c1
Sequence:CCGGACCATGTCCAAGTACTATAATCTCGAGATTATAGTACTTGGACATGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000361408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008837.2-1167s21c1
Sequence:CCGGGAGTGAGCACAGGCAACTATGCTCGAGCATAGTTGCCTGTGCTCACTCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000088598    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008837.1-1331s1c1
Sequence:CCGGGAAGGCATATAGTGGCGCATACTCGAGTATGCGCCACTATATGCCTTCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000088599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008837.1-27s1c1
Sequence:CCGGCGAAGAGGATAAATTAGGAATCTCGAGATTCCTAATTTATCCTCTTCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000088601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008837.1-338s1c1
Sequence:CCGGCCCTGGACATTGTGTTGAAGACTCGAGTCTTCAACACAATGTCCAGGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000088602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008837.1-340s1c1
Sequence:CCGGCTGGACATTGTGTTGAAGAAACTCGAGTTTCTTCAACACAATGTCCAGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000088600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008837.1-702s1c1
Sequence:CCGGCCTGAACACGTACCTCAATAACTCGAGTTATTGAGGTACGTGTTCAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008837
VALIDATED
PICK1 MISSION shRNA Lentiviral Transduction Particles
protein interacting with PRKCA 1
Mouse
10 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000368719    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008837.2-1643s21c1
Sequence:CCGGAGGCATATAGTGGCGCATAAACTCGAGTTTATGCGCCACTATATGCCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008837.2-450s21c1
Sequence:CCGGTCTATATCGTCCAGGTATTTGCTCGAGCAAATACCTGGACGATATAGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361337    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008837.2-1693s21c1
Sequence:CCGGTGCTCCTCTGTCCTCAAACAGCTCGAGCTGTTTGAGGACAGAGGAGCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008837.2-1328s21c1
Sequence:CCGGACCATGTCCAAGTACTATAATCTCGAGATTATAGTACTTGGACATGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008837.2-1167s21c1
Sequence:CCGGGAGTGAGCACAGGCAACTATGCTCGAGCATAGTTGCCTGTGCTCACTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088598    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008837.1-1331s1c1
Sequence:CCGGGAAGGCATATAGTGGCGCATACTCGAGTATGCGCCACTATATGCCTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008837.1-27s1c1
Sequence:CCGGCGAAGAGGATAAATTAGGAATCTCGAGATTCCTAATTTATCCTCTTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008837.1-338s1c1
Sequence:CCGGCCCTGGACATTGTGTTGAAGACTCGAGTCTTCAACACAATGTCCAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008837.1-340s1c1
Sequence:CCGGCTGGACATTGTGTTGAAGAAACTCGAGTTTCTTCAACACAATGTCCAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_008837.1-702s1c1
Sequence:CCGGCCTGAACACGTACCTCAATAACTCGAGTTATTGAGGTACGTGTTCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)