EMAIL THIS PAGE TO A FRIEND

PID1

phosphotyrosine interaction domain containing 1

142 Gene Product Result for
Synonyms: NYGGF4 P-CLI1 PCLI1
UniProtKB ID: Q7Z2X4, B3KU82, Q68CJ2, Q6ZUS3, Q8IXL0, Q9NWP6
Gene ID:
Mouse(98496) phosphotyrosine interaction domain containing 1
Rat(501174) phosphotyrosine interaction domain containing 1
cow(510773) phosphotyrosine interaction domain containing 1
sheep(101104810) phosphotyrosine interaction domain containing 1
naked mole-rat(101718439) phosphotyrosine interaction domain containing 1
Zebrafish(541377) phosphotyrosine interaction domain containing 1
dog(100685906) phosphotyrosine interaction domain containing 1
chicken(424787) phosphotyrosine interaction domain containing 1
dog(477398) phosphotyrosine interaction domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017933 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017933 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017933 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001003948 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001003948 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001003948 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001100818 Rosetta Predictions human pricing
NM_017933 Rosetta Predictions human pricing
NM_001110493 Rosetta Predictions rat pricing
NM_001003948 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100818 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00322377 predicted 1077
2 SASI_Hs02_00322378 predicted 656
3 SASI_Hs02_00322379 predicted 971
4 SASI_Hs02_00322380 predicted 950
5 SASI_Hs02_00322381 predicted 624
6 SASI_Hs02_00322382 predicted 736
7 SASI_Hs02_00322383 predicted 1265
8 SASI_Hs02_00322384 predicted 903
9 SASI_Hs02_00322385 predicted 591
10 SASI_Hs02_00322386 predicted 572
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017933 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00234042 predicted 1292
2 SASI_Hs01_00234043 predicted 864
3 SASI_Hs01_00234044 predicted 1184
4 SASI_Hs01_00234045 predicted 1157
5 SASI_Hs01_00234046 predicted 833
6 SASI_Hs01_00234047 predicted 947
7 SASI_Hs01_00234049 predicted 1475
8 SASI_Hs02_00350936 predicted 1115
9 SASI_Hs01_00234050 predicted 799
10 SASI_Hs02_00350937 predicted 786
11 SASI_Hs01_00234041 predicted 1431
12 SASI_Hs01_00234048 predicted 1131
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110493 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00251282 predicted 252
2 SASI_Rn02_00251283 predicted 237
3 SASI_Rn02_00251284 predicted 553
4 SASI_Rn02_00251285 predicted 413
5 SASI_Rn02_00251286 predicted 237
6 SASI_Rn02_00251287 predicted 263
7 SASI_Rn02_00251288 predicted 242
8 SASI_Rn02_00251289 predicted 276
9 SASI_Rn02_00251290 predicted 285
10 SASI_Rn02_00251291 predicted 274
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003948 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00286397 predicted 458
2 SASI_Mm01_00037654 predicted 585
3 SASI_Mm01_00037655 predicted 262
4 SASI_Mm01_00037657 predicted 608
5 SASI_Mm01_00037658 predicted 759
6 SASI_Mm01_00037659 predicted 1337
7 SASI_Mm01_00037660 predicted 571
8 SASI_Mm01_00037661 predicted 536
9 SASI_Mm01_00037663 predicted 565
10 SASI_Mm02_00286398 predicted 869
11 SASI_Mm01_00037656 predicted 305
12 SASI_Mm01_00037662 predicted 308
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017933
PID1 MISSION shRNA Bacterial Glycerol Stock
phosphotyrosine interaction domain containing 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434491    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017933.4-1221s21c1
Sequence:CCGGTGAGTAAGCAACGTTTCAAATCTCGAGATTTGAAACGTTGCTTACTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017933.4-1072s21c1
Sequence:CCGGAGACTTTCCACAGTATGAAGACTCGAGTCTTCATACTGTGGAAAGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419115    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017933.4-1400s21c1
Sequence:CCGGAGGTTCTAGGCTCTCTTATTTCTCGAGAAATAAGAGAGCCTAGAACCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017933.4-1146s21c1
Sequence:CCGGGAATCCGATGATGGCTGAATGCTCGAGCATTCAGCCATCATCGGATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017933.4-790s21c1
Sequence:CCGGAGGATGTCTTTCCGGCCAATGCTCGAGCATTGGCCGGAAAGACATCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123234    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017933.3-2000s1c1
Sequence:CCGGGCTGAGATTTATGGTAACTTACTCGAGTAAGTTACCATAAATCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017933.3-472s1c1
Sequence:CCGGGACCATGCTGAAGTCTAAATTCTCGAGAATTTAGACTTCAGCATGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017933.3-752s1c1
Sequence:CCGGCCATTCCAAGTTTGGCTCCATCTCGAGATGGAGCCAAACTTGGAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017933
PID1 MISSION shRNA shRNA Plasmid DNA
phosphotyrosine interaction domain containing 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434491    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017933.4-1221s21c1
Sequence:CCGGTGAGTAAGCAACGTTTCAAATCTCGAGATTTGAAACGTTGCTTACTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017933.4-1072s21c1
Sequence:CCGGAGACTTTCCACAGTATGAAGACTCGAGTCTTCATACTGTGGAAAGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419115    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017933.4-1400s21c1
Sequence:CCGGAGGTTCTAGGCTCTCTTATTTCTCGAGAAATAAGAGAGCCTAGAACCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017933.4-1146s21c1
Sequence:CCGGGAATCCGATGATGGCTGAATGCTCGAGCATTCAGCCATCATCGGATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017933.4-790s21c1
Sequence:CCGGAGGATGTCTTTCCGGCCAATGCTCGAGCATTGGCCGGAAAGACATCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123234    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017933.3-2000s1c1
Sequence:CCGGGCTGAGATTTATGGTAACTTACTCGAGTAAGTTACCATAAATCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017933.3-472s1c1
Sequence:CCGGGACCATGCTGAAGTCTAAATTCTCGAGAATTTAGACTTCAGCATGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017933.3-752s1c1
Sequence:CCGGCCATTCCAAGTTTGGCTCCATCTCGAGATGGAGCCAAACTTGGAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017933
PID1 MISSION shRNA Lentiviral Transduction Particles
phosphotyrosine interaction domain containing 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434491    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017933.4-1221s21c1
Sequence:CCGGTGAGTAAGCAACGTTTCAAATCTCGAGATTTGAAACGTTGCTTACTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017933.4-1072s21c1
Sequence:CCGGAGACTTTCCACAGTATGAAGACTCGAGTCTTCATACTGTGGAAAGTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419115    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017933.4-1400s21c1
Sequence:CCGGAGGTTCTAGGCTCTCTTATTTCTCGAGAAATAAGAGAGCCTAGAACCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017933.4-1146s21c1
Sequence:CCGGGAATCCGATGATGGCTGAATGCTCGAGCATTCAGCCATCATCGGATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017933.4-790s21c1
Sequence:CCGGAGGATGTCTTTCCGGCCAATGCTCGAGCATTGGCCGGAAAGACATCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123234    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017933.3-2000s1c1
Sequence:CCGGGCTGAGATTTATGGTAACTTACTCGAGTAAGTTACCATAAATCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017933.3-472s1c1
Sequence:CCGGGACCATGCTGAAGTCTAAATTCTCGAGAATTTAGACTTCAGCATGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017933.3-752s1c1
Sequence:CCGGCCATTCCAAGTTTGGCTCCATCTCGAGATGGAGCCAAACTTGGAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001003948
VALIDATED
PID1 MISSION shRNA Bacterial Glycerol Stock
phosphotyrosine interaction domain containing 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000268010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001003948.1-865s21c1
Sequence:CCGGATGATGGCTGAAGGAACTTAACTCGAGTTAAGTTCCTTCAGCCATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003948.1-368s21c1
Sequence:CCGGGATGAAGGCAAGGACTCATAGCTCGAGCTATGAGTCCTTGCCTTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001003948.1-667s21c1
Sequence:CCGGGGGTGTACAGAGAGATCAATGCTCGAGCATTGATCTCTCTGTACACCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268013    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001003948.1-1455s21c1
Sequence:CCGGGGCAGTTAATTCGCAGTTAAACTCGAGTTTAACTGCGAATTAACTGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001003948.1-761s21c1
Sequence:CCGGCGCCATGATGGAGGCATTCAACTCGAGTTGAATGCCTCCATCATGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184442    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003948.1-394s1c1
Sequence:CCGGGCAAGGTTACCTATCTGGGAACTCGAGTTCCCAGATAGGTAACCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184412    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003948.1-554s1c1
Sequence:CCGGGCTTCATCACCTTGACCACAACTCGAGTTGTGGTCAAGGTGATGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183547    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001003948.1-2231s1c1
Sequence:CCGGGCCTTAAATGAGAGCTAATATCTCGAGATATTAGCTCTCATTTAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001003948
VALIDATED
PID1 MISSION shRNA shRNA Plasmid DNA
phosphotyrosine interaction domain containing 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000268010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001003948.1-865s21c1
Sequence:CCGGATGATGGCTGAAGGAACTTAACTCGAGTTAAGTTCCTTCAGCCATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000283575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003948.1-368s21c1
Sequence:CCGGGATGAAGGCAAGGACTCATAGCTCGAGCTATGAGTCCTTGCCTTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001003948.1-667s21c1
Sequence:CCGGGGGTGTACAGAGAGATCAATGCTCGAGCATTGATCTCTCTGTACACCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268013    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001003948.1-1455s21c1
Sequence:CCGGGGCAGTTAATTCGCAGTTAAACTCGAGTTTAACTGCGAATTAACTGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001003948.1-761s21c1
Sequence:CCGGCGCCATGATGGAGGCATTCAACTCGAGTTGAATGCCTCCATCATGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184442    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003948.1-394s1c1
Sequence:CCGGGCAAGGTTACCTATCTGGGAACTCGAGTTCCCAGATAGGTAACCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184412    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003948.1-554s1c1
Sequence:CCGGGCTTCATCACCTTGACCACAACTCGAGTTGTGGTCAAGGTGATGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183547    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001003948.1-2231s1c1
Sequence:CCGGGCCTTAAATGAGAGCTAATATCTCGAGATATTAGCTCTCATTTAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001003948
VALIDATED
PID1 MISSION shRNA Lentiviral Transduction Particles
phosphotyrosine interaction domain containing 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000268010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001003948.1-865s21c1
Sequence:CCGGATGATGGCTGAAGGAACTTAACTCGAGTTAAGTTCCTTCAGCCATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003948.1-368s21c1
Sequence:CCGGGATGAAGGCAAGGACTCATAGCTCGAGCTATGAGTCCTTGCCTTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001003948.1-667s21c1
Sequence:CCGGGGGTGTACAGAGAGATCAATGCTCGAGCATTGATCTCTCTGTACACCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268013    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001003948.1-1455s21c1
Sequence:CCGGGGCAGTTAATTCGCAGTTAAACTCGAGTTTAACTGCGAATTAACTGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001003948.1-761s21c1
Sequence:CCGGCGCCATGATGGAGGCATTCAACTCGAGTTGAATGCCTCCATCATGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184442    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003948.1-394s1c1
Sequence:CCGGGCAAGGTTACCTATCTGGGAACTCGAGTTCCCAGATAGGTAACCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184412    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003948.1-554s1c1
Sequence:CCGGGCTTCATCACCTTGACCACAACTCGAGTTGTGGTCAAGGTGATGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183547    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001003948.1-2231s1c1
Sequence:CCGGGCCTTAAATGAGAGCTAATATCTCGAGATATTAGCTCTCATTTAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)