EMAIL THIS PAGE TO A FRIEND

PIEZO1

piezo-type mechanosensitive ion channel component 1

90 Gene Product Result for
Synonyms: DHS FAM38A Mib
UniProtKB ID: Q92508, A6NHT9, A7E2B7, Q0KKZ9
Gene ID:
Human(9780) Summary: Piezos are large transmembrane proteins conserved among various species, all having between 24 and 36 predicted transmembrane domains. 'Piezo' comes from the Greek 'piesi,' meaning 'pressure.' The FAM38A gene encodes PIEZO1, a protein that induces mechanically activated (MA) currents in various cell types (Coste et al., 2010 [PubMed 20813920]
Mouse(234839) piezo-type mechanosensitive ion channel component 1
Rat(361430) piezo-type mechanosensitive ion channel component 1
Zebrafish(567949) piezo-type mechanosensitive ion channel component 1
domestic cat(101098421) piezo-type mechanosensitive ion channel component 1
dog(489662) piezo-type mechanosensitive ion channel component 1
cow(789183) piezo-type mechanosensitive ion channel component 1
sheep(101107813) piezo-type mechanosensitive ion channel component 1
domestic guinea pig(100733448) piezo-type mechanosensitive ion channel component 1
naked mole-rat(101709586) piezo-type mechanosensitive ion channel component 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014745 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014745 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014745 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU135531 MISSION® esiRNA esiRNA human FAM38A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014745 Rosetta Predictions human pricing
XM_001714313 Rosetta Predictions human pricing
XM_001714598 Rosetta Predictions human pricing
XM_001717096 Rosetta Predictions human pricing
NM_001077200 Rosetta Predictions rat pricing
XM_341708 Rosetta Predictions rat pricing
XM_001001166 Rosetta Predictions mouse pricing
XM_001481316 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014745 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00208584 predicted 275
2 SASI_Hs01_00208585 predicted 5900
3 SASI_Hs01_00208586 predicted 4515
4 SASI_Hs01_00208587 predicted 5016
5 SASI_Hs01_00208588 predicted 3980
6 SASI_Hs01_00208589 predicted 5930
7 SASI_Hs01_00208590 predicted 4527
8 SASI_Hs01_00208591 predicted 1222
9 SASI_Hs01_00208592 predicted 5440
10 SASI_Hs01_00208593 predicted 4994
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001714313 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00396295 predicted 7102
2 SASI_Hs02_00396296 predicted 1251
3 SASI_Hs02_00396297 predicted 2709
4 SASI_Hs02_00396298 predicted 6953
5 SASI_Hs02_00396299 predicted 3691
6 SASI_Hs02_00396300 predicted 6066
7 SASI_Hs02_00396301 predicted 894
8 SASI_Hs02_00396302 predicted 6970
9 SASI_Hs02_00396303 predicted 3660
10 SASI_Hs02_00396304 predicted 5575
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001714598 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00398173 predicted 6307
2 SASI_Hs02_00398174 predicted 6304
3 SASI_Hs02_00398175 predicted 6342
4 SASI_Hs02_00398176 predicted 6342
5 SASI_Hs02_00398177 predicted 6288
6 SASI_Hs02_00398178 predicted 6336
7 SASI_Hs02_00398179 predicted 6305
8 SASI_Hs02_00398180 predicted 6304
9 SASI_Hs02_00398181 predicted 6308
10 SASI_Hs02_00398182 predicted 6297
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001717096 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00414968 predicted 1254
2 SASI_Hs02_00414969 predicted 2705
3 SASI_Hs02_00414970 predicted 7470
4 SASI_Hs02_00414971 predicted 3691
5 SASI_Hs02_00414972 predicted 6583
6 SASI_Hs02_00414973 predicted 888
7 SASI_Hs02_00414974 predicted 5548
8 SASI_Hs02_00414975 predicted 7496
9 SASI_Hs02_00414976 predicted 3660
10 SASI_Hs02_00414977 predicted 6093
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077200 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00207482 predicted 4322
2 SASI_Rn02_00207483 predicted 5138
3 SASI_Rn02_00207484 predicted 5351
4 SASI_Rn02_00207485 predicted 5022
5 SASI_Rn02_00207486 predicted 1695
6 SASI_Rn02_00207487 predicted 4836
7 SASI_Rn02_00207488 predicted 2556
8 SASI_Rn02_00207489 predicted 533
9 SASI_Rn02_00207490 predicted 1972
10 SASI_Rn02_00207491 predicted 3861
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341708 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00155434 predicted 8582
2 SASI_Rn01_00155435 predicted 9403
3 SASI_Rn01_00155436 predicted 1436
4 SASI_Rn01_00155437 predicted 6014
5 SASI_Rn01_00155438 predicted 9101
6 SASI_Rn01_00155439 predicted 3741
7 SASI_Rn01_00155440 predicted 6866
8 SASI_Rn01_00155441 predicted 4750
9 SASI_Rn01_00155442 predicted 3683
10 SASI_Rn01_00155443 predicted 1343
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001001166 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00281158 predicted 1096
2 SASI_Mm01_00281159 predicted 5598
3 SASI_Mm01_00281160 predicted 3306
4 SASI_Mm01_00281161 predicted 1092
5 SASI_Mm01_00281162 predicted 3208
6 SASI_Mm01_00281163 predicted 2680
7 SASI_Mm01_00281164 predicted 2214
8 SASI_Mm01_00281165 predicted 4278
9 SASI_Mm01_00281166 predicted 2147
10 SASI_Mm01_00281167 predicted 4162
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001481316 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00423664 predicted 5566
2 SASI_Mm02_00423665 predicted 6752
3 SASI_Mm02_00423666 predicted 3301
4 SASI_Mm02_00423667 predicted 6303
5 SASI_Mm02_00423668 predicted 3207
6 SASI_Mm02_00423669 predicted 2681
7 SASI_Mm02_00423670 predicted 2208
8 SASI_Mm02_00423671 predicted 4270
9 SASI_Mm02_00423672 predicted 7240
10 SASI_Mm02_00423673 predicted 7227
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014745
PIEZO1 MISSION shRNA Bacterial Glycerol Stock
piezo-type mechanosensitive ion channel component 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000121969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014745.1-4824s1c1
Sequence:CCGGCTCACCAAGAAGTACAATCATCTCGAGATGATTGTACTTCTTGGTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143190    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014745.1-4742s1c1
Sequence:CCGGGTACTTCGTGAAGTGCATCTACTCGAGTAGATGCACTTCACGAAGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014745.1-1729s1c1
Sequence:CCGGCCCTGTGCATTGATTATCCCTCTCGAGAGGGATAATCAATGCACAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014745.1-3608s1c1
Sequence:CCGGGCTGCTCTGCTACTTCATCATCTCGAGATGATGAAGTAGCAGAGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014745.1-5933s1c1
Sequence:CCGGGCACTCCATTATGTTCGAGGACTCGAGTCCTCGAACATAATGGAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014745.1-4059s1c1
Sequence:CCGGGAAGACCACATTCAGGTGGAACTCGAGTTCCACCTGAATGTGGTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141867    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014745.1-2204s1c1
Sequence:CCGGGTACAACGTCACCGTCATCATCTCGAGATGATGACGGTGACGTTGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014745
PIEZO1 MISSION shRNA shRNA Plasmid DNA
piezo-type mechanosensitive ion channel component 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000121969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014745.1-4824s1c1
Sequence:CCGGCTCACCAAGAAGTACAATCATCTCGAGATGATTGTACTTCTTGGTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143190    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014745.1-4742s1c1
Sequence:CCGGGTACTTCGTGAAGTGCATCTACTCGAGTAGATGCACTTCACGAAGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014745.1-1729s1c1
Sequence:CCGGCCCTGTGCATTGATTATCCCTCTCGAGAGGGATAATCAATGCACAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014745.1-3608s1c1
Sequence:CCGGGCTGCTCTGCTACTTCATCATCTCGAGATGATGAAGTAGCAGAGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014745.1-5933s1c1
Sequence:CCGGGCACTCCATTATGTTCGAGGACTCGAGTCCTCGAACATAATGGAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014745.1-4059s1c1
Sequence:CCGGGAAGACCACATTCAGGTGGAACTCGAGTTCCACCTGAATGTGGTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141867    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014745.1-2204s1c1
Sequence:CCGGGTACAACGTCACCGTCATCATCTCGAGATGATGACGGTGACGTTGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014745
PIEZO1 MISSION shRNA Lentiviral Transduction Particles
piezo-type mechanosensitive ion channel component 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000121969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014745.1-4824s1c1
Sequence:CCGGCTCACCAAGAAGTACAATCATCTCGAGATGATTGTACTTCTTGGTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143190    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014745.1-4742s1c1
Sequence:CCGGGTACTTCGTGAAGTGCATCTACTCGAGTAGATGCACTTCACGAAGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014745.1-1729s1c1
Sequence:CCGGCCCTGTGCATTGATTATCCCTCTCGAGAGGGATAATCAATGCACAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014745.1-3608s1c1
Sequence:CCGGGCTGCTCTGCTACTTCATCATCTCGAGATGATGAAGTAGCAGAGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014745.1-5933s1c1
Sequence:CCGGGCACTCCATTATGTTCGAGGACTCGAGTCCTCGAACATAATGGAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014745.1-4059s1c1
Sequence:CCGGGAAGACCACATTCAGGTGGAACTCGAGTTCCACCTGAATGTGGTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141867    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014745.1-2204s1c1
Sequence:CCGGGTACAACGTCACCGTCATCATCTCGAGATGATGACGGTGACGTTGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)