EMAIL THIS PAGE TO A FRIEND

PIEZO2

piezo-type mechanosensitive ion channel component 2

77 Gene Product Result for
Synonyms: C18orf30 C18orf58 FAM38B FAM38B2 HsT748 HsT771
UniProtKB ID: Q9H5I5, B7Z812, Q8N787, Q8NAR6, Q9H5R4
Gene ID:
Human(63895) Summary: Piezos are large transmembrane proteins conserved among various species, all having between 24 and 36 predicted transmembrane domains. 'Piezo' comes from the Greek 'piesi,' meaning 'pressure.' The PIEZO2 protein has a role in rapidly adapting mechanically activated (MA) currents in somatosensory neurons (Coste et al., 2010 [PubMed 20813920]
Mouse(667742) piezo-type mechanosensitive ion channel component 2
Rat(307380) piezo-type mechanosensitive ion channel component 2
domestic cat(101099334) piezo-type mechanosensitive ion channel component 2
dog(490554) piezo-type mechanosensitive ion channel component 2
naked mole-rat(101720096) piezo-type mechanosensitive ion channel component 2
domestic guinea pig(100734606) piezo-type mechanosensitive ion channel component 2
cow(522631) piezo-type mechanosensitive ion channel component 2
sheep(101105203) piezo-type mechanosensitive ion channel component 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022068 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022068 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022068 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022068 Rosetta Predictions human pricing
XM_225880 Rosetta Predictions rat pricing
XM_001478778 Rosetta Predictions mouse pricing
XM_001480289 Rosetta Predictions mouse pricing
XM_992130 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022068 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00179965 predicted 228
2 SASI_Hs01_00179966 predicted 368
3 SASI_Hs01_00179967 predicted 408
4 SASI_Hs01_00179968 predicted 1072
5 SASI_Hs01_00179969 predicted 1429
6 SASI_Hs01_00179970 predicted 1447
7 SASI_Hs01_00179971 predicted 461
8 SASI_Hs01_00179972 predicted 1406
9 SASI_Hs02_00355433 predicted 1278
10 SASI_Hs01_00179973 predicted 1252
11 SASI_Hs01_00179974 predicted 385
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_225880 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00383190 predicted 3587
2 SASI_Rn02_00383191 predicted 4223
3 SASI_Rn02_00383192 predicted 3568
4 SASI_Rn02_00383193 predicted 689
5 SASI_Rn02_00383194 predicted 3355
6 SASI_Rn02_00383195 predicted 700
7 SASI_Rn02_00383196 predicted 3090
8 SASI_Rn02_00383197 predicted 2664
9 SASI_Rn02_00383198 predicted 3523
10 SASI_Rn02_00383199 predicted 1469
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001478778 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00405285 predicted 2383
2 SASI_Mm02_00405286 predicted 4292
3 SASI_Mm02_00405287 predicted 4113
4 SASI_Mm02_00405288 predicted 4145
5 SASI_Mm02_00405289 predicted 5617
6 SASI_Mm02_00405290 predicted 2548
7 SASI_Mm02_00405291 predicted 3605
8 SASI_Mm02_00405292 predicted 5242
9 SASI_Mm02_00405293 predicted 4235
10 SASI_Mm02_00405294 predicted 5271
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001480289 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00416442 predicted 304
2 SASI_Mm02_00416443 predicted 236
3 SASI_Mm02_00416444 predicted 267
4 SASI_Mm02_00416445 predicted 293
5 SASI_Mm02_00416446 predicted 206
6 SASI_Mm02_00416447 predicted 239
7 SASI_Mm02_00416448 predicted 292
8 SASI_Mm02_00416449 predicted 275
9 SASI_Mm02_00416450 predicted 250
10 SASI_Mm02_00416451 predicted 202
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_992130 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00274283 predicted 2385
2 SASI_Mm01_00274284 predicted 4301
3 SASI_Mm01_00274285 predicted 4124
4 SASI_Mm01_00274286 predicted 4148
5 SASI_Mm01_00274287 predicted 5621
6 SASI_Mm01_00274288 predicted 2549
7 SASI_Mm01_00274289 predicted 3606
8 SASI_Mm01_00274290 predicted 5249
9 SASI_Mm01_00274291 predicted 4244
10 SASI_Mm01_00274292 predicted 5282
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022068
VALIDATED
PIEZO2 MISSION shRNA Bacterial Glycerol Stock
piezo-type mechanosensitive ion channel component 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123249    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022068.1-1728s1c1
Sequence:CCGGGCATTTCTAGTTCGACGGAAACTCGAGTTTCCGTCGAACTAGAAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022068.1-547s1c1
Sequence:CCGGCCTCACCAAGAGCTACAATTACTCGAGTAATTGTAGCTCTTGGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022068.1-1392s1c1
Sequence:CCGGGCTATGGTATTATGGGATTATCTCGAGATAATCCCATAATACCATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022068.1-1248s1c1
Sequence:CCGGCCAGAGACAATACAACTAAATCTCGAGATTTAGTTGTATTGTCTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022068.1-758s1c1
Sequence:CCGGGCCCAACAAAGCCAGTTGAAACTCGAGTTTCAACTGGCTTTGTTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022068
VALIDATED
PIEZO2 MISSION shRNA shRNA Plasmid DNA
piezo-type mechanosensitive ion channel component 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123249    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022068.1-1728s1c1
Sequence:CCGGGCATTTCTAGTTCGACGGAAACTCGAGTTTCCGTCGAACTAGAAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022068.1-547s1c1
Sequence:CCGGCCTCACCAAGAGCTACAATTACTCGAGTAATTGTAGCTCTTGGTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022068.1-1392s1c1
Sequence:CCGGGCTATGGTATTATGGGATTATCTCGAGATAATCCCATAATACCATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022068.1-1248s1c1
Sequence:CCGGCCAGAGACAATACAACTAAATCTCGAGATTTAGTTGTATTGTCTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022068.1-758s1c1
Sequence:CCGGGCCCAACAAAGCCAGTTGAAACTCGAGTTTCAACTGGCTTTGTTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022068
VALIDATED
PIEZO2 MISSION shRNA Lentiviral Transduction Particles
piezo-type mechanosensitive ion channel component 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123249    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022068.1-1728s1c1
Sequence:CCGGGCATTTCTAGTTCGACGGAAACTCGAGTTTCCGTCGAACTAGAAATGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000123251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022068.1-547s1c1
Sequence:CCGGCCTCACCAAGAGCTACAATTACTCGAGTAATTGTAGCTCTTGGTGAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000123252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022068.1-1392s1c1
Sequence:CCGGGCTATGGTATTATGGGATTATCTCGAGATAATCCCATAATACCATAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000121963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022068.1-1248s1c1
Sequence:CCGGCCAGAGACAATACAACTAAATCTCGAGATTTAGTTGTATTGTCTCTGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000123253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022068.1-758s1c1
Sequence:CCGGGCCCAACAAAGCCAGTTGAAACTCGAGTTTCAACTGGCTTTGTTGGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???