EMAIL THIS PAGE TO A FRIEND

PIGA

phosphatidylinositol glycan anchor biosynthesis, class A

208 Gene Product Result for
Synonyms: GPI3 MCAHS2 PIG-A
UniProtKB ID: P37287, B4E0V2, Q16025, Q16250
Gene ID:
Human(5277) Summary: This gene encodes a protein required for synthesis of N-acetylglucosaminyl phosphatidylinositol (GlcNAc-PI), the first intermediate in the biosynthetic pathway of GPI anchor. The GPI anchor is a glycolipid found on many blood cells and which serves to anchor proteins to the cell surface. Paroxysmal nocturnal hemoglobinuria, an acquired hematologic disorder, has been shown to result from mutations in this gene. Alternate splice variants have been characterized. A related pseudogene is located on chromosome 12. [provided by RefSeq, Jun 2010]
Mouse(18700) phosphatidylinositol glycan anchor biosynthesis, class A
Rat(363464) phosphatidylinositol glycan anchor biosynthesis, class A
Zebrafish(791759) phosphatidylinositol glycan anchor biosynthesis, class A
dog(491748) phosphatidylinositol glycan anchor biosynthesis, class A
Horse(100055827) phosphatidylinositol glycan anchor biosynthesis, class A
domestic cat(101094735) phosphatidylinositol glycan anchor biosynthesis, class A
chicken(418624) phosphatidylinositol glycan anchor biosynthesis, class A
cow(100139601) phosphatidylinositol glycan anchor biosynthesis, class A
sheep(101102455) phosphatidylinositol glycan anchor biosynthesis, class A
domestic guinea pig(100713611) phosphatidylinositol glycan anchor biosynthesis, class A
naked mole-rat(101724876) phosphatidylinositol glycan anchor biosynthesis, class A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002641 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002641 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002641 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011081 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011081 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011081 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002641 Rosetta Predictions human pricing
NM_020472 Rosetta Predictions human pricing
NM_020473 Rosetta Predictions human pricing
NM_001108816 Rosetta Predictions rat pricing
NM_011081 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002641 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00139204 predicted 1310
2 SASI_Hs01_00139205 predicted 2042
3 SASI_Hs01_00139206 predicted 2048
4 SASI_Hs01_00139207 predicted 1023
5 SASI_Hs01_00139208 predicted 2031
6 SASI_Hs01_00139209 predicted 1912
7 SASI_Hs01_00139210 predicted 1033
8 SASI_Hs02_00334171 predicted 1092
9 SASI_Hs01_00139212 predicted 1280
10 SASI_Hs01_00139213 predicted 1062
11 SASI_Hs01_00139211 predicted 1080
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020472 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00067934 predicted 642
2 SASI_Hs01_00067935 predicted 641
3 SASI_Hs01_00067936 predicted 895
4 SASI_Hs01_00067937 predicted 777
5 SASI_Hs01_00067938 predicted 262
6 SASI_Hs01_00067939 predicted 355
7 SASI_Hs01_00067940 predicted 182
8 SASI_Hs01_00067941 predicted 296
9 SASI_Hs01_00067942 predicted 600
10 SASI_Hs01_00067943 predicted 431
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020473 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00226475 predicted 652
2 SASI_Hs02_00353548 predicted 1384
3 SASI_Hs02_00353549 predicted 1383
4 SASI_Hs02_00353550 predicted 650
5 SASI_Hs02_00353551 predicted 1378
6 SASI_Hs02_00353552 predicted 1255
7 SASI_Hs02_00353553 predicted 596
8 SASI_Hs02_00353554 predicted 430
9 SASI_Hs01_00226472 predicted 622
10 SASI_Hs02_00353555 predicted 401
11 SASI_Hs01_00226470 predicted 357
12 SASI_Hs01_00226471 predicted 364
13 SASI_Hs01_00226473 predicted 493
14 SASI_Hs01_00226474 predicted 222
15 SASI_Hs01_00226476 predicted 318
16 SASI_Hs01_00226477 predicted 311
17 SASI_Hs01_00226478 predicted 417
18 SASI_Hs01_00226479 predicted 163
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108816 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00242355 predicted 878
2 SASI_Rn02_00242356 predicted 861
3 SASI_Rn02_00242357 predicted 287
4 SASI_Rn02_00242358 predicted 326
5 SASI_Rn02_00242359 predicted 739
6 SASI_Rn02_00242360 predicted 790
7 SASI_Rn02_00242361 predicted 886
8 SASI_Rn02_00242362 predicted 387
9 SASI_Rn02_00242363 predicted 582
10 SASI_Rn02_00242364 predicted 541
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011081 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00042202 predicted 1589
2 SASI_Mm01_00042203 predicted 1603
3 SASI_Mm01_00042204 predicted 451
4 SASI_Mm01_00042205 predicted 1583
5 SASI_Mm01_00042206 predicted 773
6 SASI_Mm01_00042207 predicted 607
7 SASI_Mm01_00042208 predicted 1171
8 SASI_Mm01_00042209 predicted 992
9 SASI_Mm01_00042210 predicted 709
10 SASI_Mm01_00042211 predicted 881
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002641
VALIDATED
PIGA MISSION shRNA Bacterial Glycerol Stock
phosphatidylinositol glycan anchor biosynthesis, class A
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002641.1-601s1c1
Sequence:CCGGCGTGTCTCTTTGTGATACAAACTCGAGTTTGTATCACAAAGAGACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002641.1-683s1c1
Sequence:CCGGCCTGAAATAGTGTCCGTCATTCTCGAGAATGACGGACACTATTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002641.1-261s1c1
Sequence:CCGGGCCTGATTGAAAGAGGGCATACTCGAGTATGCCCTCTTTCAATCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083343    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_002641.1-2329s1c1
Sequence:CCGGGCCTCCATCTTCAGTTGTGTTCTCGAGAACACAACTGAAGATGGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002641.1-298s1c1
Sequence:CCGGCCATGCTTATGGAAATCGAAACTCGAGTTTCGATTTCCATAAGCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002641
VALIDATED
PIGA MISSION shRNA shRNA Plasmid DNA
phosphatidylinositol glycan anchor biosynthesis, class A
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002641.1-601s1c1
Sequence:CCGGCGTGTCTCTTTGTGATACAAACTCGAGTTTGTATCACAAAGAGACACGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000083345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002641.1-683s1c1
Sequence:CCGGCCTGAAATAGTGTCCGTCATTCTCGAGAATGACGGACACTATTTCAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000083346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002641.1-261s1c1
Sequence:CCGGGCCTGATTGAAAGAGGGCATACTCGAGTATGCCCTCTTTCAATCAGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000083343    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_002641.1-2329s1c1
Sequence:CCGGGCCTCCATCTTCAGTTGTGTTCTCGAGAACACAACTGAAGATGGAGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000083347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002641.1-298s1c1
Sequence:CCGGCCATGCTTATGGAAATCGAAACTCGAGTTTCGATTTCCATAAGCATGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002641
VALIDATED
PIGA MISSION shRNA Lentiviral Transduction Particles
phosphatidylinositol glycan anchor biosynthesis, class A
Human
5 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000083344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002641.1-601s1c1
Sequence:CCGGCGTGTCTCTTTGTGATACAAACTCGAGTTTGTATCACAAAGAGACACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002641.1-683s1c1
Sequence:CCGGCCTGAAATAGTGTCCGTCATTCTCGAGAATGACGGACACTATTTCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002641.1-261s1c1
Sequence:CCGGGCCTGATTGAAAGAGGGCATACTCGAGTATGCCCTCTTTCAATCAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083343    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_002641.1-2329s1c1
Sequence:CCGGGCCTCCATCTTCAGTTGTGTTCTCGAGAACACAACTGAAGATGGAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002641.1-298s1c1
Sequence:CCGGCCATGCTTATGGAAATCGAAACTCGAGTTTCGATTTCCATAAGCATGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011081
VALIDATED
PIGA MISSION shRNA Bacterial Glycerol Stock
phosphatidylinositol glycan anchor biosynthesis, class A
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000077119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011081.1-913s1c1
Sequence:CCGGCGGGAAAGATACCAACTACATCTCGAGATGTAGTTGGTATCTTTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011081.1-1429s1c1
Sequence:CCGGCCAGACTCTTTCATTGATGTTCTCGAGAACATCAATGAAAGAGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011081.2-446s21c1
Sequence:CCGGGCCATTGCTCAGGTACATATTCTCGAGAATATGTACCTGAGCAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077118    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011081.1-1845s1c1
Sequence:CCGGGCCAAATGTTTCTGGATTGTTCTCGAGAACAATCCAGAAACATTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011081.1-417s1c1
Sequence:CCGGGCCATTGCTCAGGTACATATTCTCGAGAATATGTACCTGAGCAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011081.2-199s21c1
Sequence:CCGGATAGGACCTGCACCCATAATACTCGAGTATTATGGGTGCAGGTCCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011081.2-470s21c1
Sequence:CCGGTCGGGAGAGAATTACGATAATCTCGAGATTATCGTAATTCTCTCCCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011081.1-299s1c2
Sequence:CCGGCCCATGCTTATGGAAATCGAACTCGAGTTCGATTTCCATAAGCATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302928    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011081.2-1874s21c1
Sequence:CCGGGCCAAATGTTTCTGGATTGTTCTCGAGAACAATCCAGAAACATTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011081.2-776s21c1
Sequence:CCGGTAGGAGGCATGATAGTGTAATCTCGAGATTACACTATCATGCCTCCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011081
VALIDATED
PIGA MISSION shRNA shRNA Plasmid DNA
phosphatidylinositol glycan anchor biosynthesis, class A
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000077119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011081.1-913s1c1
Sequence:CCGGCGGGAAAGATACCAACTACATCTCGAGATGTAGTTGGTATCTTTCCCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000077121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011081.1-1429s1c1
Sequence:CCGGCCAGACTCTTTCATTGATGTTCTCGAGAACATCAATGAAAGAGTCTGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000302844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011081.2-446s21c1
Sequence:CCGGGCCATTGCTCAGGTACATATTCTCGAGAATATGTACCTGAGCAATGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000077118    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011081.1-1845s1c1
Sequence:CCGGGCCAAATGTTTCTGGATTGTTCTCGAGAACAATCCAGAAACATTTGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000077122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011081.1-417s1c1
Sequence:CCGGGCCATTGCTCAGGTACATATTCTCGAGAATATGTACCTGAGCAATGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000311227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011081.2-199s21c1
Sequence:CCGGATAGGACCTGCACCCATAATACTCGAGTATTATGGGTGCAGGTCCTATTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000304996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011081.2-470s21c1
Sequence:CCGGTCGGGAGAGAATTACGATAATCTCGAGATTATCGTAATTCTCTCCCGATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000222631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011081.1-299s1c2
Sequence:CCGGCCCATGCTTATGGAAATCGAACTCGAGTTCGATTTCCATAAGCATGGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000302928    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011081.2-1874s21c1
Sequence:CCGGGCCAAATGTTTCTGGATTGTTCTCGAGAACAATCCAGAAACATTTGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000305029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011081.2-776s21c1
Sequence:CCGGTAGGAGGCATGATAGTGTAATCTCGAGATTACACTATCATGCCTCCTATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011081
VALIDATED
PIGA MISSION shRNA Lentiviral Transduction Particles
phosphatidylinositol glycan anchor biosynthesis, class A
Mouse
10 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000077119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011081.1-913s1c1
Sequence:CCGGCGGGAAAGATACCAACTACATCTCGAGATGTAGTTGGTATCTTTCCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011081.1-1429s1c1
Sequence:CCGGCCAGACTCTTTCATTGATGTTCTCGAGAACATCAATGAAAGAGTCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011081.2-446s21c1
Sequence:CCGGGCCATTGCTCAGGTACATATTCTCGAGAATATGTACCTGAGCAATGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077118    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011081.1-1845s1c1
Sequence:CCGGGCCAAATGTTTCTGGATTGTTCTCGAGAACAATCCAGAAACATTTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011081.1-417s1c1
Sequence:CCGGGCCATTGCTCAGGTACATATTCTCGAGAATATGTACCTGAGCAATGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011081.2-199s21c1
Sequence:CCGGATAGGACCTGCACCCATAATACTCGAGTATTATGGGTGCAGGTCCTATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011081.2-470s21c1
Sequence:CCGGTCGGGAGAGAATTACGATAATCTCGAGATTATCGTAATTCTCTCCCGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000222631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011081.1-299s1c2
Sequence:CCGGCCCATGCTTATGGAAATCGAACTCGAGTTCGATTTCCATAAGCATGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302928    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011081.2-1874s21c1
Sequence:CCGGGCCAAATGTTTCTGGATTGTTCTCGAGAACAATCCAGAAACATTTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011081.2-776s21c1
Sequence:CCGGTAGGAGGCATGATAGTGTAATCTCGAGATTACACTATCATGCCTCCTATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)