EMAIL THIS PAGE TO A FRIEND

PIGC

phosphatidylinositol glycan anchor biosynthesis, class C

77 Gene Product Result for
Synonyms: GPI2
UniProtKB ID: Q92535, O14491
Gene ID:
Human(5279) Summary: This gene encodes an endoplasmic reticulum associated protein that is involved in glycosylphosphatidylinositol (GPI) lipid anchor biosynthesis. The GPI lipid anchor is a glycolipid found on many blood cells and serves to anchor proteins to the cell surface. The encoded protein is one subunit of the GPI N-acetylglucosaminyl (GlcNAc) transferase that transfers GlcNAc to phosphatidylinositol (PI) on the cytoplasmic side of the endoplasmic reticulum. Two alternatively spliced transcripts that encode the same protein have been found for this gene. A pseudogene on chromosome 11 has also been characterized. [provided by RefSeq, Jul 2008]
Mouse(67292) phosphatidylinositol glycan anchor biosynthesis, class C
Rat(364032) phosphatidylinositol glycan anchor biosynthesis, class C
cow(510483) phosphatidylinositol glycan anchor biosynthesis, class C
sheep(101107373) phosphatidylinositol glycan anchor biosynthesis, class C
domestic guinea pig(100717955) phosphatidylinositol glycan anchor biosynthesis, class C
naked mole-rat(101700079) phosphatidylinositol glycan anchor biosynthesis, class C
Zebrafish(323994) phosphatidylinositol glycan, class C
chicken(424387) phosphatidylinositol glycan anchor biosynthesis, class C
domestic cat(101090480) phosphatidylinositol glycan anchor biosynthesis, class C
dog(480073) phosphatidylinositol glycan anchor biosynthesis, class C
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002642 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002642 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002642 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026078 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026078 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026078 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU007821 MISSION® esiRNA esiRNA targeting human PIGC (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002642 Rosetta Predictions human pricing
NM_153747 Rosetta Predictions human pricing
NM_001012207 Rosetta Predictions rat pricing
NM_001039045 Rosetta Predictions mouse pricing
NM_026078 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002642 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00216993 predicted 834
2 SASI_Hs01_00216996 predicted 797
3 SASI_Hs02_00334172 predicted 644
4 SASI_Hs01_00216994 predicted 368
5 SASI_Hs01_00216995 predicted 588
6 SASI_Hs01_00216997 predicted 1128
7 SASI_Hs02_00334173 predicted 873
8 SASI_Hs02_00334174 predicted 755
9 SASI_Hs02_00334175 predicted 843
10 SASI_Hs02_00334176 predicted 447
11 SASI_Hs01_00216998 predicted 1101
12 SASI_Hs01_00216999 predicted 754
13 SASI_Hs01_00217000 predicted 754
14 SASI_Hs01_00217001 predicted 361
15 SASI_Hs01_00217002 predicted 549
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153747 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00049265 predicted 810
2 SASI_Hs01_00049268 predicted 772
3 SASI_Hs02_00367457 predicted 621
4 SASI_Hs01_00049266 predicted 350
5 SASI_Hs01_00049267 predicted 570
6 SASI_Hs01_00049269 predicted 1106
7 SASI_Hs02_00367458 predicted 847
8 SASI_Hs02_00367459 predicted 731
9 SASI_Hs02_00367460 predicted 823
10 SASI_Hs02_00367461 predicted 427
11 SASI_Hs01_00049270 predicted 1084
12 SASI_Hs01_00049271 predicted 740
13 SASI_Hs01_00049272 predicted 725
14 SASI_Hs01_00049273 predicted 332
15 SASI_Hs01_00049274 predicted 530
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012207 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00036453 predicted 287
2 SASI_Rn01_00036454 predicted 1012
3 SASI_Rn02_00200451 predicted 502
4 SASI_Rn01_00036455 predicted 748
5 SASI_Rn01_00036456 predicted 658
6 SASI_Rn01_00036457 predicted 691
7 SASI_Rn01_00036458 predicted 575
8 SASI_Rn01_00036459 predicted 1018
9 SASI_Rn01_00036460 predicted 657
10 SASI_Rn01_00036462 predicted 1084
11 SASI_Rn01_00036461 predicted 504
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039045 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00055876 predicted 742
2 SASI_Mm01_00055877 predicted 675
3 SASI_Mm01_00055878 predicted 1095
4 SASI_Mm01_00055879 predicted 745
5 SASI_Mm01_00055880 predicted 892
6 SASI_Mm01_00055881 predicted 502
7 SASI_Mm01_00055882 predicted 370
8 SASI_Mm01_00055883 predicted 573
9 SASI_Mm01_00055884 predicted 828
10 SASI_Mm01_00055885 predicted 573
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026078 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00027087 predicted 756
2 SASI_Mm01_00027088 predicted 682
3 SASI_Mm01_00027089 predicted 1103
4 SASI_Mm01_00027090 predicted 752
5 SASI_Mm01_00027091 predicted 903
6 SASI_Mm01_00027092 predicted 519
7 SASI_Mm01_00027093 predicted 382
8 SASI_Mm01_00027094 predicted 582
9 SASI_Mm01_00027095 predicted 845
10 SASI_Mm01_00027096 predicted 578
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002642
VALIDATED
PIGC MISSION shRNA Bacterial Glycerol Stock
phosphatidylinositol glycan anchor biosynthesis, class C
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000163360    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002642.3-1303s1c1
Sequence:CCGGGTTCCATTCTGGAAGCAGCATCTCGAGATGCTGCTTCCAGAATGGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161099    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_002642.3-1259s1c1
Sequence:CCGGGCTGATAGATTAGCCTCCTAACTCGAGTTAGGAGGCTAATCTATCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_002642.3-605s1c1
Sequence:CCGGGCTTCTTCACTGATTGGGTATCTCGAGATACCCAATCAGTGAAGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159449    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_002642.3-1262s1c1
Sequence:CCGGGATAGATTAGCCTCCTAACTACTCGAGTAGTTAGGAGGCTAATCTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_002642.3-1105s1c1
Sequence:CCGGGCTGATGTCTATCTCATGTCTCTCGAGAGACATGAGATAGACATCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160808    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002642.3-934s1c1
Sequence:CCGGCATCATGGTGACATTTGCCATCTCGAGATGGCAAATGTCACCATGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160487    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_002642.3-1321s1c1
Sequence:CCGGCATGTCATTGTGGTAAGAGAACTCGAGTTCTCTTACCACAATGACATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002642.3-893s21c1
Sequence:CCGGGTATGCTTGGCATCACGTCTTCTCGAGAAGACGTGATGCCAAGCATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002642.3-1116s21c1
Sequence:CCGGTCTCATGTCTGTGTCCATTCTCTCGAGAGAATGGACACAGACATGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002642.3-1053s21c1
Sequence:CCGGTGGGAGGCCTACTGTCCATTACTCGAGTAATGGACAGTAGGCCTCCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002642.3-929s21c1
Sequence:CCGGGCCTTCATCATGGTGACATTTCTCGAGAAATGTCACCATGATGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343157    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002642.3-1231s21c1
Sequence:CCGGTAGGACATCCATTACATTATTCTCGAGAATAATGTAATGGATGTCCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002642
VALIDATED
PIGC MISSION shRNA shRNA Plasmid DNA
phosphatidylinositol glycan anchor biosynthesis, class C
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000163360    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002642.3-1303s1c1
Sequence:CCGGGTTCCATTCTGGAAGCAGCATCTCGAGATGCTGCTTCCAGAATGGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161099    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_002642.3-1259s1c1
Sequence:CCGGGCTGATAGATTAGCCTCCTAACTCGAGTTAGGAGGCTAATCTATCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_002642.3-605s1c1
Sequence:CCGGGCTTCTTCACTGATTGGGTATCTCGAGATACCCAATCAGTGAAGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159449    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_002642.3-1262s1c1
Sequence:CCGGGATAGATTAGCCTCCTAACTACTCGAGTAGTTAGGAGGCTAATCTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_002642.3-1105s1c1
Sequence:CCGGGCTGATGTCTATCTCATGTCTCTCGAGAGACATGAGATAGACATCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160808    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002642.3-934s1c1
Sequence:CCGGCATCATGGTGACATTTGCCATCTCGAGATGGCAAATGTCACCATGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160487    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_002642.3-1321s1c1
Sequence:CCGGCATGTCATTGTGGTAAGAGAACTCGAGTTCTCTTACCACAATGACATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002642.3-893s21c1
Sequence:CCGGGTATGCTTGGCATCACGTCTTCTCGAGAAGACGTGATGCCAAGCATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002642.3-1116s21c1
Sequence:CCGGTCTCATGTCTGTGTCCATTCTCTCGAGAGAATGGACACAGACATGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002642.3-1053s21c1
Sequence:CCGGTGGGAGGCCTACTGTCCATTACTCGAGTAATGGACAGTAGGCCTCCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002642.3-929s21c1
Sequence:CCGGGCCTTCATCATGGTGACATTTCTCGAGAAATGTCACCATGATGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343157    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002642.3-1231s21c1
Sequence:CCGGTAGGACATCCATTACATTATTCTCGAGAATAATGTAATGGATGTCCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002642
VALIDATED
PIGC MISSION shRNA Lentiviral Transduction Particles
phosphatidylinositol glycan anchor biosynthesis, class C
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000163360    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002642.3-1303s1c1
Sequence:CCGGGTTCCATTCTGGAAGCAGCATCTCGAGATGCTGCTTCCAGAATGGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161099    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_002642.3-1259s1c1
Sequence:CCGGGCTGATAGATTAGCCTCCTAACTCGAGTTAGGAGGCTAATCTATCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_002642.3-605s1c1
Sequence:CCGGGCTTCTTCACTGATTGGGTATCTCGAGATACCCAATCAGTGAAGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159449    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_002642.3-1262s1c1
Sequence:CCGGGATAGATTAGCCTCCTAACTACTCGAGTAGTTAGGAGGCTAATCTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_002642.3-1105s1c1
Sequence:CCGGGCTGATGTCTATCTCATGTCTCTCGAGAGACATGAGATAGACATCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160808    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002642.3-934s1c1
Sequence:CCGGCATCATGGTGACATTTGCCATCTCGAGATGGCAAATGTCACCATGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160487    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_002642.3-1321s1c1
Sequence:CCGGCATGTCATTGTGGTAAGAGAACTCGAGTTCTCTTACCACAATGACATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002642.3-893s21c1
Sequence:CCGGGTATGCTTGGCATCACGTCTTCTCGAGAAGACGTGATGCCAAGCATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002642.3-1116s21c1
Sequence:CCGGTCTCATGTCTGTGTCCATTCTCTCGAGAGAATGGACACAGACATGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002642.3-1053s21c1
Sequence:CCGGTGGGAGGCCTACTGTCCATTACTCGAGTAATGGACAGTAGGCCTCCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002642.3-929s21c1
Sequence:CCGGGCCTTCATCATGGTGACATTTCTCGAGAAATGTCACCATGATGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343157    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002642.3-1231s21c1
Sequence:CCGGTAGGACATCCATTACATTATTCTCGAGAATAATGTAATGGATGTCCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026078
VALIDATED
PIGC MISSION shRNA Bacterial Glycerol Stock
phosphatidylinositol glycan anchor biosynthesis, class C
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000077124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026078.1-873s1c1
Sequence:CCGGGCCTTCATTATGGTGACGTTTCTCGAGAAACGTCACCATAATGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026078.1-345s1c1
Sequence:CCGGCCGTTCCCTGATAACTATGTTCTCGAGAACATAGTTATCAGGGAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026078.1-1068s1c1
Sequence:CCGGCTCTGCCCTTACTACCTCATTCTCGAGAATGAGGTAGTAAGGGCAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077123    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026078.1-1400s1c1
Sequence:CCGGCCCTGTAACAAATGATGTAATCTCGAGATTACATCATTTGTTACAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026078.2-1192s21c1
Sequence:CCGGGTCTAGGTTCCTTAGCTAATCCTCGAGGATTAGCTAAGGAACCTAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026078.2-383s21c1
Sequence:CCGGCCGTTCCCTGATAACTATGTTCTCGAGAACATAGTTATCAGGGAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302848    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026078.2-1438s21c1
Sequence:CCGGCCCTGTAACAAATGATGTAATCTCGAGATTACATCATTTGTTACAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026078.2-1106s21c1
Sequence:CCGGCTCTGCCCTTACTACCTCATTCTCGAGAATGAGGTAGTAAGGGCAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026078.1-549s1c2
Sequence:CCGGGCATCTTCCTTGGTTGGGTATCTCGAGATACCCAACCAAGGAAGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026078.2-911s21c1
Sequence:CCGGGCCTTCATTATGGTGACGTTTCTCGAGAAACGTCACCATAATGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026078
VALIDATED
PIGC MISSION shRNA shRNA Plasmid DNA
phosphatidylinositol glycan anchor biosynthesis, class C
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000077124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026078.1-873s1c1
Sequence:CCGGGCCTTCATTATGGTGACGTTTCTCGAGAAACGTCACCATAATGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026078.1-345s1c1
Sequence:CCGGCCGTTCCCTGATAACTATGTTCTCGAGAACATAGTTATCAGGGAACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026078.1-1068s1c1
Sequence:CCGGCTCTGCCCTTACTACCTCATTCTCGAGAATGAGGTAGTAAGGGCAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077123    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026078.1-1400s1c1
Sequence:CCGGCCCTGTAACAAATGATGTAATCTCGAGATTACATCATTTGTTACAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026078.2-1192s21c1
Sequence:CCGGGTCTAGGTTCCTTAGCTAATCCTCGAGGATTAGCTAAGGAACCTAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026078.2-383s21c1
Sequence:CCGGCCGTTCCCTGATAACTATGTTCTCGAGAACATAGTTATCAGGGAACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302848    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026078.2-1438s21c1
Sequence:CCGGCCCTGTAACAAATGATGTAATCTCGAGATTACATCATTTGTTACAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026078.2-1106s21c1
Sequence:CCGGCTCTGCCCTTACTACCTCATTCTCGAGAATGAGGTAGTAAGGGCAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000222662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026078.1-549s1c2
Sequence:CCGGGCATCTTCCTTGGTTGGGTATCTCGAGATACCCAACCAAGGAAGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026078.2-911s21c1
Sequence:CCGGGCCTTCATTATGGTGACGTTTCTCGAGAAACGTCACCATAATGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026078
VALIDATED
PIGC MISSION shRNA Lentiviral Transduction Particles
phosphatidylinositol glycan anchor biosynthesis, class C
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000077124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026078.1-873s1c1
Sequence:CCGGGCCTTCATTATGGTGACGTTTCTCGAGAAACGTCACCATAATGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026078.1-345s1c1
Sequence:CCGGCCGTTCCCTGATAACTATGTTCTCGAGAACATAGTTATCAGGGAACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026078.1-1068s1c1
Sequence:CCGGCTCTGCCCTTACTACCTCATTCTCGAGAATGAGGTAGTAAGGGCAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077123    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026078.1-1400s1c1
Sequence:CCGGCCCTGTAACAAATGATGTAATCTCGAGATTACATCATTTGTTACAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026078.2-1192s21c1
Sequence:CCGGGTCTAGGTTCCTTAGCTAATCCTCGAGGATTAGCTAAGGAACCTAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302845    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026078.2-383s21c1
Sequence:CCGGCCGTTCCCTGATAACTATGTTCTCGAGAACATAGTTATCAGGGAACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302848    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026078.2-1438s21c1
Sequence:CCGGCCCTGTAACAAATGATGTAATCTCGAGATTACATCATTTGTTACAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026078.2-1106s21c1
Sequence:CCGGCTCTGCCCTTACTACCTCATTCTCGAGAATGAGGTAGTAAGGGCAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026078.1-549s1c2
Sequence:CCGGGCATCTTCCTTGGTTGGGTATCTCGAGATACCCAACCAAGGAAGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026078.2-911s21c1
Sequence:CCGGGCCTTCATTATGGTGACGTTTCTCGAGAAACGTCACCATAATGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)