EMAIL THIS PAGE TO A FRIEND

PIGF

phosphatidylinositol glycan anchor biosynthesis, class F

59 Gene Product Result for
UniProtKB ID: Q07326, Q8WW20
Gene ID:
Human(5281) Summary: This gene encodes a protein involved in glycosylphosphatidylinositol (GPI)-anchor biosynthesis. The GPI-anchor, a glycolipid containing three mannose molecules in its core backbone, is found on many blood cells where it serves to anchor proteins to the cell surface. The encoded protein and another GPI synthesis protein, PIGO, function in the transfer of ethanolaminephosphate to the third mannose in GPI. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Mouse(18701) phosphatidylinositol glycan anchor biosynthesis, class F
Rat(681086) phosphatidylinositol glycan anchor biosynthesis, class F
Zebrafish(402942) phosphatidylinositol glycan, class F
chicken(100858021) phosphatidylinositol glycan anchor biosynthesis, class F
dog(474580) phosphatidylinositol glycan anchor biosynthesis, class F
domestic cat(101101456) phosphatidylinositol glycan anchor biosynthesis, class F
naked mole-rat(101702704) phosphatidylinositol glycan anchor biosynthesis, class F
domestic guinea pig(100722365) phosphatidylinositol glycan anchor biosynthesis, class F
cow(768015) phosphatidylinositol glycan anchor biosynthesis, class F
sheep(101109604) phosphatidylinositol glycan anchor biosynthesis, class F
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008838 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008838 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008838 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002643 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002643 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002643 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002643 Rosetta Predictions human pricing
NM_173074 Rosetta Predictions human pricing
XM_001060262 Rosetta Predictions rat pricing
NM_008838 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002643 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00043839 predicted 375
2 SASI_Hs01_00043840 predicted 312
3 SASI_Hs01_00043841 predicted 274
4 SASI_Hs02_00334177 predicted 240
5 SASI_Hs01_00043842 predicted 411
6 SASI_Hs01_00043843 predicted 476
7 SASI_Hs01_00043844 predicted 468
8 SASI_Hs01_00043845 predicted 323
9 SASI_Hs01_00043847 predicted 323
10 SASI_Hs01_00043848 predicted 459
11 SASI_Hs01_00043846 predicted 365
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173074 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00138414 predicted 378
2 SASI_Hs01_00138415 predicted 316
3 SASI_Hs01_00138416 predicted 281
4 SASI_Hs02_00368062 predicted 242
5 SASI_Hs01_00138417 predicted 412
6 SASI_Hs01_00138418 predicted 472
7 SASI_Hs01_00138419 predicted 468
8 SASI_Hs01_00138420 predicted 324
9 SASI_Hs01_00138422 predicted 319
10 SASI_Hs01_00138423 predicted 462
11 SASI_Hs01_00138421 predicted 359
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060262 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00295863 predicted 738
2 SASI_Rn02_00295864 predicted 700
3 SASI_Rn02_00295865 predicted 724
4 SASI_Rn02_00295866 predicted 736
5 SASI_Rn02_00295867 predicted 733
6 SASI_Rn02_00295868 predicted 722
7 SASI_Rn02_00295869 predicted 694
8 SASI_Rn02_00295870 predicted 744
9 SASI_Rn02_00295871 predicted 698
10 SASI_Rn02_00295872 predicted 743
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008838 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00107821 predicted 580
2 SASI_Mm01_00107822 predicted 631
3 SASI_Mm02_00314775 predicted 716
4 SASI_Mm01_00107823 predicted 590
5 SASI_Mm01_00107824 predicted 737
6 SASI_Mm01_00107825 predicted 219
7 SASI_Mm01_00107826 predicted 283
8 SASI_Mm01_00107827 predicted 553
9 SASI_Mm01_00107829 predicted 570
10 SASI_Mm01_00107830 predicted 545
11 SASI_Mm01_00107828 predicted 242
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008838
VALIDATED
PIGF MISSION shRNA Bacterial Glycerol Stock
phosphatidylinositol glycan anchor biosynthesis, class F
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000301303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008838.1-498s21c1
Sequence:CCGGGTACCTTGTCTCTGTTTGTTACTCGAGTAACAAACAGAGACAAGGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008838.1-285s21c1
Sequence:CCGGGTCAATCTCTTGTCGTACTTACTCGAGTAAGTACGACAAGAGATTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077128    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008838.1-786s1c1
Sequence:CCGGGAGGAGAAAGGAGAGAAGTTACTCGAGTAACTTCTCTCCTTTCTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008838.1-498s1c1
Sequence:CCGGGTACCTTGTCTCTGTTTGTTACTCGAGTAACAAACAGAGACAAGGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008838.1-639s1c1
Sequence:CCGGCCTATTCCACTGGATTGGGAACTCGAGTTCCCAATCCAGTGGAATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008838.1-215s1c1
Sequence:CCGGCGTGGACAACTTCTCAGTATTCTCGAGAATACTGAGAAGTTGTCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008838.1-215s21c1
Sequence:CCGGCGTGGACAACTTCTCAGTATTCTCGAGAATACTGAGAAGTTGTCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301306    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008838.1-786s21c1
Sequence:CCGGGAGGAGAAAGGAGAGAAGTTACTCGAGTAACTTCTCTCCTTTCTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008838.1-285s1c1
Sequence:CCGGGTCAATCTCTTGTCGTACTTACTCGAGTAAGTACGACAAGAGATTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008838
VALIDATED
PIGF MISSION shRNA shRNA Plasmid DNA
phosphatidylinositol glycan anchor biosynthesis, class F
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000301303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008838.1-498s21c1
Sequence:CCGGGTACCTTGTCTCTGTTTGTTACTCGAGTAACAAACAGAGACAAGGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008838.1-285s21c1
Sequence:CCGGGTCAATCTCTTGTCGTACTTACTCGAGTAAGTACGACAAGAGATTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077128    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008838.1-786s1c1
Sequence:CCGGGAGGAGAAAGGAGAGAAGTTACTCGAGTAACTTCTCTCCTTTCTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008838.1-498s1c1
Sequence:CCGGGTACCTTGTCTCTGTTTGTTACTCGAGTAACAAACAGAGACAAGGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008838.1-639s1c1
Sequence:CCGGCCTATTCCACTGGATTGGGAACTCGAGTTCCCAATCCAGTGGAATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008838.1-215s1c1
Sequence:CCGGCGTGGACAACTTCTCAGTATTCTCGAGAATACTGAGAAGTTGTCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008838.1-215s21c1
Sequence:CCGGCGTGGACAACTTCTCAGTATTCTCGAGAATACTGAGAAGTTGTCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301306    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008838.1-786s21c1
Sequence:CCGGGAGGAGAAAGGAGAGAAGTTACTCGAGTAACTTCTCTCCTTTCTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008838.1-285s1c1
Sequence:CCGGGTCAATCTCTTGTCGTACTTACTCGAGTAAGTACGACAAGAGATTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008838
VALIDATED
PIGF MISSION shRNA Lentiviral Transduction Particles
phosphatidylinositol glycan anchor biosynthesis, class F
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000301303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008838.1-498s21c1
Sequence:CCGGGTACCTTGTCTCTGTTTGTTACTCGAGTAACAAACAGAGACAAGGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008838.1-285s21c1
Sequence:CCGGGTCAATCTCTTGTCGTACTTACTCGAGTAAGTACGACAAGAGATTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077128    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008838.1-786s1c1
Sequence:CCGGGAGGAGAAAGGAGAGAAGTTACTCGAGTAACTTCTCTCCTTTCTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008838.1-498s1c1
Sequence:CCGGGTACCTTGTCTCTGTTTGTTACTCGAGTAACAAACAGAGACAAGGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008838.1-639s1c1
Sequence:CCGGCCTATTCCACTGGATTGGGAACTCGAGTTCCCAATCCAGTGGAATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008838.1-215s1c1
Sequence:CCGGCGTGGACAACTTCTCAGTATTCTCGAGAATACTGAGAAGTTGTCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008838.1-215s21c1
Sequence:CCGGCGTGGACAACTTCTCAGTATTCTCGAGAATACTGAGAAGTTGTCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301306    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008838.1-786s21c1
Sequence:CCGGGAGGAGAAAGGAGAGAAGTTACTCGAGTAACTTCTCTCCTTTCTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008838.1-285s1c1
Sequence:CCGGGTCAATCTCTTGTCGTACTTACTCGAGTAAGTACGACAAGAGATTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002643
VALIDATED
PIGF MISSION shRNA Bacterial Glycerol Stock
phosphatidylinositol glycan anchor biosynthesis, class F
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000154221    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_002643.2-842s1c1
Sequence:CCGGCAAAGCCAAGCAGTTCCATTTCTCGAGAAATGGAACTGCTTGGCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_002643.2-436s1c1
Sequence:CCGGGAGTTGGCATTGGAAACATTTCTCGAGAAATGTTTCCAATGCCAACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_002643.2-526s1c1
Sequence:CCGGGCATGGCTAAGAGTGTTCAGTCTCGAGACTGAACACTCTTAGCCATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002643.2-515s1c1
Sequence:CCGGCAAACCTCAAAGCATGGCTAACTCGAGTTAGCCATGCTTTGAGGTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_002643.2-204s1c1
Sequence:CCGGCTTCTTGGAGAACTTCTCAATCTCGAGATTGAGAAGTTCTCCAAGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002643
VALIDATED
PIGF MISSION shRNA shRNA Plasmid DNA
phosphatidylinositol glycan anchor biosynthesis, class F
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000154221    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_002643.2-842s1c1
Sequence:CCGGCAAAGCCAAGCAGTTCCATTTCTCGAGAAATGGAACTGCTTGGCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_002643.2-436s1c1
Sequence:CCGGGAGTTGGCATTGGAAACATTTCTCGAGAAATGTTTCCAATGCCAACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_002643.2-526s1c1
Sequence:CCGGGCATGGCTAAGAGTGTTCAGTCTCGAGACTGAACACTCTTAGCCATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002643.2-515s1c1
Sequence:CCGGCAAACCTCAAAGCATGGCTAACTCGAGTTAGCCATGCTTTGAGGTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_002643.2-204s1c1
Sequence:CCGGCTTCTTGGAGAACTTCTCAATCTCGAGATTGAGAAGTTCTCCAAGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002643
VALIDATED
PIGF MISSION shRNA Lentiviral Transduction Particles
phosphatidylinositol glycan anchor biosynthesis, class F
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000154221    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_002643.2-842s1c1
Sequence:CCGGCAAAGCCAAGCAGTTCCATTTCTCGAGAAATGGAACTGCTTGGCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_002643.2-436s1c1
Sequence:CCGGGAGTTGGCATTGGAAACATTTCTCGAGAAATGTTTCCAATGCCAACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_002643.2-526s1c1
Sequence:CCGGGCATGGCTAAGAGTGTTCAGTCTCGAGACTGAACACTCTTAGCCATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002643.2-515s1c1
Sequence:CCGGCAAACCTCAAAGCATGGCTAACTCGAGTTAGCCATGCTTTGAGGTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_002643.2-204s1c1
Sequence:CCGGCTTCTTGGAGAACTTCTCAATCTCGAGATTGAGAAGTTCTCCAAGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)