EMAIL THIS PAGE TO A FRIEND

PIGG

phosphatidylinositol glycan anchor biosynthesis, class G

148 Gene Product Result for
Synonyms: GPI7 LAS21 PRO4405 RLGS1930
Gene ID:
Mouse(433931) phosphatidylinositol glycan anchor biosynthesis, class G
Rat(305626) phosphatidylinositol glycan anchor biosynthesis, class G
Zebrafish(100538291) phosphatidylinositol glycan anchor biosynthesis, class G
Horse(100050713) phosphatidylinositol glycan anchor biosynthesis, class G
domestic cat(101095255) phosphatidylinositol glycan anchor biosynthesis, class G
chicken(427290) phosphatidylinositol glycan anchor biosynthesis, class G
dog(479136) phosphatidylinositol glycan anchor biosynthesis, class G
cow(511496) phosphatidylinositol glycan anchor biosynthesis, class G
sheep(101109018) phosphatidylinositol glycan anchor biosynthesis, class G
domestic guinea pig(100732735) phosphatidylinositol glycan anchor biosynthesis, class G
naked mole-rat(101705380) phosphatidylinositol glycan anchor biosynthesis, class G
Domestic Rabbit(100348293) phosphatidylinositol glycan anchor biosynthesis, class G
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017733 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017733 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017733 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081234 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081234 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081234 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001127178 Rosetta Predictions human pricing
NM_017733 Rosetta Predictions human pricing
XM_001060543 Rosetta Predictions rat pricing
XM_223731 Rosetta Predictions rat pricing
NM_001081234 Rosetta Predictions mouse pricing
XM_485660 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127178 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00328567 predicted 2519
2 SASI_Hs02_00328568 predicted 2581
3 SASI_Hs02_00328569 predicted 618
4 SASI_Hs02_00328570 predicted 1691
5 SASI_Hs02_00328571 predicted 469
6 SASI_Hs02_00328572 predicted 2390
7 SASI_Hs02_00328573 predicted 987
8 SASI_Hs02_00328574 predicted 2832
9 SASI_Hs02_00328575 predicted 1218
10 SASI_Hs02_00328576 predicted 2757
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017733 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00231570 predicted 2497
2 SASI_Hs01_00231571 predicted 2557
3 SASI_Hs01_00231572 predicted 620
4 SASI_Hs01_00231573 predicted 1670
5 SASI_Hs01_00231574 predicted 470
6 SASI_Hs01_00231575 predicted 2366
7 SASI_Hs01_00231576 predicted 986
8 SASI_Hs02_00350518 predicted 2805
9 SASI_Hs01_00231577 predicted 1226
10 SASI_Hs02_00350519 predicted 2730
11 SASI_Hs01_00231578 predicted 464
12 SASI_Hs01_00231579 predicted 1973
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060543 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00296952 predicted 2878
2 SASI_Rn02_00296953 predicted 2203
3 SASI_Rn02_00296954 predicted 2983
4 SASI_Rn02_00296955 predicted 1052
5 SASI_Rn02_00296956 predicted 1333
6 SASI_Rn02_00296957 predicted 2710
7 SASI_Rn02_00296958 predicted 1153
8 SASI_Rn02_00296959 predicted 815
9 SASI_Rn02_00296960 predicted 1740
10 SASI_Rn02_00296961 predicted 2889
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_223731 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00381630 predicted 2224
2 SASI_Rn02_00381631 predicted 2872
3 SASI_Rn02_00381632 predicted 2695
4 SASI_Rn02_00381633 predicted 2210
5 SASI_Rn02_00381634 predicted 2975
6 SASI_Rn02_00381635 predicted 3334
7 SASI_Rn02_00381636 predicted 3094
8 SASI_Rn02_00381637 predicted 1332
9 SASI_Rn02_00381638 predicted 2712
10 SASI_Rn02_00381639 predicted 2828
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081234 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00296487 predicted 348
2 SASI_Mm02_00296488 predicted 2236
3 SASI_Mm02_00296489 predicted 2507
4 SASI_Mm02_00296490 predicted 331
5 SASI_Mm02_00296491 predicted 2019
6 SASI_Mm02_00296492 predicted 2092
7 SASI_Mm02_00296493 predicted 2494
8 SASI_Mm02_00296494 predicted 1541
9 SASI_Mm02_00296495 predicted 866
10 SASI_Mm02_00296496 predicted 717
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_485660 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00242669 predicted 349
2 SASI_Mm01_00242670 predicted 335
3 SASI_Mm01_00242671 predicted 578
4 SASI_Mm01_00242672 predicted 338
5 SASI_Mm01_00242673 predicted 865
6 SASI_Mm01_00242674 predicted 591
7 SASI_Mm01_00242675 predicted 731
8 SASI_Mm01_00242676 predicted 668
9 SASI_Mm01_00242677 predicted 697
10 SASI_Mm01_00242678 predicted 431
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017733
PIGG MISSION shRNA Bacterial Glycerol Stock
phosphatidylinositol glycan anchor biosynthesis, class G
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017733.2-1201s1c1
Sequence:CCGGGCAAGAGAATGTGCCGTCATACTCGAGTATGACGGCACATTCTCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017733.2-1183s1c1
Sequence:CCGGGCAGCTTAGTAAACTGTTGCACTCGAGTGCAACAGTTTACTAAGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017733.2-2609s1c1
Sequence:CCGGGCTGAGATTACTGTGATGCATCTCGAGATGCATCACAGTAATCTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017733.2-1202s1c1
Sequence:CCGGCAAGAGAATGTGCCGTCATATCTCGAGATATGACGGCACATTCTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017733.2-1738s1c1
Sequence:CCGGGCTAGACCTTCTTATTCTGTTCTCGAGAACAGAATAAGAAGGTCTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017733.3-2926s21c1
Sequence:CCGGGACATCTCTGCGTTATCATTTCTCGAGAAATGATAACGCAGAGATGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017733
PIGG MISSION shRNA shRNA Plasmid DNA
phosphatidylinositol glycan anchor biosynthesis, class G
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017733.2-1201s1c1
Sequence:CCGGGCAAGAGAATGTGCCGTCATACTCGAGTATGACGGCACATTCTCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017733.2-1183s1c1
Sequence:CCGGGCAGCTTAGTAAACTGTTGCACTCGAGTGCAACAGTTTACTAAGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017733.2-2609s1c1
Sequence:CCGGGCTGAGATTACTGTGATGCATCTCGAGATGCATCACAGTAATCTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017733.2-1202s1c1
Sequence:CCGGCAAGAGAATGTGCCGTCATATCTCGAGATATGACGGCACATTCTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017733.2-1738s1c1
Sequence:CCGGGCTAGACCTTCTTATTCTGTTCTCGAGAACAGAATAAGAAGGTCTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017733.3-2926s21c1
Sequence:CCGGGACATCTCTGCGTTATCATTTCTCGAGAAATGATAACGCAGAGATGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017733
PIGG MISSION shRNA Lentiviral Transduction Particles
phosphatidylinositol glycan anchor biosynthesis, class G
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017733.2-1201s1c1
Sequence:CCGGGCAAGAGAATGTGCCGTCATACTCGAGTATGACGGCACATTCTCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017733.2-1183s1c1
Sequence:CCGGGCAGCTTAGTAAACTGTTGCACTCGAGTGCAACAGTTTACTAAGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017733.2-2609s1c1
Sequence:CCGGGCTGAGATTACTGTGATGCATCTCGAGATGCATCACAGTAATCTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017733.2-1202s1c1
Sequence:CCGGCAAGAGAATGTGCCGTCATATCTCGAGATATGACGGCACATTCTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017733.2-1738s1c1
Sequence:CCGGGCTAGACCTTCTTATTCTGTTCTCGAGAACAGAATAAGAAGGTCTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017733.3-2926s21c1
Sequence:CCGGGACATCTCTGCGTTATCATTTCTCGAGAAATGATAACGCAGAGATGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081234
PIGG MISSION shRNA Bacterial Glycerol Stock
phosphatidylinositol glycan anchor biosynthesis, class G
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000254670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081234.1-2565s21c1
Sequence:CCGGCATTGCTACCATCGACATTTCCTCGAGGAAATGTCGATGGTAGCAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254669    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081234.1-3178s21c1
Sequence:CCGGTGAGTGAGTTGTGGCTATTATCTCGAGATAATAGCCACAACTCACTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081234.1-2538s21c1
Sequence:CCGGCTTCTATTTCCAGGGTAATTCCTCGAGGAATTACCCTGGAAATAGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081234.1-1695s21c1
Sequence:CCGGAGAGCACCAGACGTGGTATTTCTCGAGAAATACCACGTCTGGTGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081234.1-2790s21c1
Sequence:CCGGGACATCTCTGCGCTATCATTTCTCGAGAAATGATAGCGCAGAGATGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081234
PIGG MISSION shRNA shRNA Plasmid DNA
phosphatidylinositol glycan anchor biosynthesis, class G
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000254670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081234.1-2565s21c1
Sequence:CCGGCATTGCTACCATCGACATTTCCTCGAGGAAATGTCGATGGTAGCAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254669    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081234.1-3178s21c1
Sequence:CCGGTGAGTGAGTTGTGGCTATTATCTCGAGATAATAGCCACAACTCACTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081234.1-2538s21c1
Sequence:CCGGCTTCTATTTCCAGGGTAATTCCTCGAGGAATTACCCTGGAAATAGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081234.1-1695s21c1
Sequence:CCGGAGAGCACCAGACGTGGTATTTCTCGAGAAATACCACGTCTGGTGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081234.1-2790s21c1
Sequence:CCGGGACATCTCTGCGCTATCATTTCTCGAGAAATGATAGCGCAGAGATGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081234
PIGG MISSION shRNA Lentiviral Transduction Particles
phosphatidylinositol glycan anchor biosynthesis, class G
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000254670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081234.1-2565s21c1
Sequence:CCGGCATTGCTACCATCGACATTTCCTCGAGGAAATGTCGATGGTAGCAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254669    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081234.1-3178s21c1
Sequence:CCGGTGAGTGAGTTGTGGCTATTATCTCGAGATAATAGCCACAACTCACTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081234.1-2538s21c1
Sequence:CCGGCTTCTATTTCCAGGGTAATTCCTCGAGGAATTACCCTGGAAATAGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081234.1-1695s21c1
Sequence:CCGGAGAGCACCAGACGTGGTATTTCTCGAGAAATACCACGTCTGGTGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081234.1-2790s21c1
Sequence:CCGGGACATCTCTGCGCTATCATTTCTCGAGAAATGATAGCGCAGAGATGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)