EMAIL THIS PAGE TO A FRIEND

PIGH

phosphatidylinositol glycan anchor biosynthesis, class H

97 Gene Product Result for
Synonyms: GPI-H
UniProtKB ID: Q14442, B2RAA4
Gene ID:
Human(5283) Summary: This gene encodes an endoplasmic reticulum associated protein that is involved in glycosylphosphatidylinositol (GPI)-anchor biosynthesis. The GPI anchor is a glycolipid found on many blood cells and which serves to anchor proteins to the cell surface. The protein encoded by this gene is a subunit of the GPI N-acetylglucosaminyl (GlcNAc) transferase that transfers GlcNAc to phosphatidylinositol (PI) on the cytoplasmic side of the endoplasmic reticulum. [provided by RefSeq, Jul 2008]
Mouse(110417) phosphatidylinositol glycan anchor biosynthesis, class H
Rat(362756) phosphatidylinositol glycan anchor biosynthesis, class H
naked mole-rat(101719292) phosphatidylinositol glycan anchor biosynthesis, class H
domestic guinea pig(100717476) phosphatidylinositol glycan anchor biosynthesis, class H
cow(515306) phosphatidylinositol glycan anchor biosynthesis, class H
sheep(101114362) phosphatidylinositol glycan anchor biosynthesis, class H
Zebrafish(436838) phosphatidylinositol glycan anchor biosynthesis, class H
domestic cat(101092442) phosphatidylinositol glycan anchor biosynthesis, class H
dog(611566) phosphatidylinositol glycan anchor biosynthesis, class H
chicken(423271) phosphatidylinositol glycan anchor biosynthesis, class H
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004569 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004569 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004569 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029988 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029988 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029988 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004569 Rosetta Predictions human pricing
NM_001108714 Rosetta Predictions rat pricing
NM_029988 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004569 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00063826 predicted 804
2 SASI_Hs01_00063827 predicted 776
3 SASI_Hs01_00063828 predicted 309
4 SASI_Hs01_00063829 predicted 257
5 SASI_Hs01_00063830 predicted 307
6 SASI_Hs01_00063831 predicted 946
7 SASI_Hs01_00063833 predicted 769
8 SASI_Hs01_00063834 predicted 254
9 SASI_Hs01_00063835 predicted 794
10 SASI_Hs02_00337899 predicted 548
11 SASI_Hs01_00063832 predicted 910
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108714 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00241355 predicted 736
2 SASI_Rn02_00241356 predicted 583
3 SASI_Rn02_00241357 predicted 763
4 SASI_Rn02_00241358 predicted 281
5 SASI_Rn02_00241359 predicted 647
6 SASI_Rn02_00241360 predicted 573
7 SASI_Rn02_00241361 predicted 547
8 SASI_Rn02_00241362 predicted 600
9 SASI_Rn02_00241363 predicted 334
10 SASI_Rn02_00241364 predicted 758
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029988 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00336331 predicted 758
2 SASI_Mm02_00336332 predicted 661
3 SASI_Mm02_00336333 predicted 594
4 SASI_Mm02_00336334 predicted 602
5 SASI_Mm02_00336335 predicted 293
6 SASI_Mm02_00336336 predicted 947
7 SASI_Mm02_00336337 predicted 376
8 SASI_Mm02_00336338 predicted 661
9 SASI_Mm02_00336339 predicted 498
10 SASI_Mm02_00336340 predicted 1000
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004569
VALIDATED
PIGH MISSION shRNA Bacterial Glycerol Stock
phosphatidylinositol glycan anchor biosynthesis, class H
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000344434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004569.3-299s21c1
Sequence:CCGGGCCATCTTCATCACCCTCTTACTCGAGTAAGAGGGTGATGAAGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004569.3-388s21c1
Sequence:CCGGCATTCAGATGACTTCATCTTACTCGAGTAAGATGAAGTCATCTGAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004569.2-344s1c1
Sequence:CCGGCCCTTGGCATTCAGATGACTTCTCGAGAAGTCATCTGAATGCCAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004569.2-351s1c1
Sequence:CCGGCATTCAGATGACTTCATCTTACTCGAGTAAGATGAAGTCATCTGAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004569.2-319s1c1
Sequence:CCGGCAGGAGACTCTGTTAATCATTCTCGAGAATGATTAACAGAGTCTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004569.2-381s1c1
Sequence:CCGGCAAAGAAAGCACTACCTTCATCTCGAGATGAAGGTAGTGCTTTCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004569.2-441s1c1
Sequence:CCGGCATTTACATGCAGAAGGTGATCTCGAGATCACCTTCTGCATGTAAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160205    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004569.2-789s1c1
Sequence:CCGGCTCAGTATATTTCCGTGTATTCTCGAGAATACACGGAAATATACTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004569.2-262s1c1
Sequence:CCGGGCCATCTTCATCACCCTCTTACTCGAGTAAGAGGGTGATGAAGATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004569.2-368s1c1
Sequence:CCGGCTTATGCTTCAGGCAAAGAAACTCGAGTTTCTTTGCCTGAAGCATAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004569.3-452s21c1
Sequence:CCGGGTCAAGGATATTGTCATCAATCTCGAGATTGATGACAATATCCTTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004569.2-415s1c1
Sequence:CCGGGTCAAGGATATTGTCATCAATCTCGAGATTGATGACAATATCCTTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004569.3-356s21c1
Sequence:CCGGCAGGAGACTCTGTTAATCATTCTCGAGAATGATTAACAGAGTCTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004569
VALIDATED
PIGH MISSION shRNA shRNA Plasmid DNA
phosphatidylinositol glycan anchor biosynthesis, class H
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000344434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004569.3-299s21c1
Sequence:CCGGGCCATCTTCATCACCCTCTTACTCGAGTAAGAGGGTGATGAAGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004569.3-388s21c1
Sequence:CCGGCATTCAGATGACTTCATCTTACTCGAGTAAGATGAAGTCATCTGAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004569.2-344s1c1
Sequence:CCGGCCCTTGGCATTCAGATGACTTCTCGAGAAGTCATCTGAATGCCAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004569.2-351s1c1
Sequence:CCGGCATTCAGATGACTTCATCTTACTCGAGTAAGATGAAGTCATCTGAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004569.2-319s1c1
Sequence:CCGGCAGGAGACTCTGTTAATCATTCTCGAGAATGATTAACAGAGTCTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004569.2-381s1c1
Sequence:CCGGCAAAGAAAGCACTACCTTCATCTCGAGATGAAGGTAGTGCTTTCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004569.2-441s1c1
Sequence:CCGGCATTTACATGCAGAAGGTGATCTCGAGATCACCTTCTGCATGTAAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160205    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004569.2-789s1c1
Sequence:CCGGCTCAGTATATTTCCGTGTATTCTCGAGAATACACGGAAATATACTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004569.2-262s1c1
Sequence:CCGGGCCATCTTCATCACCCTCTTACTCGAGTAAGAGGGTGATGAAGATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004569.2-368s1c1
Sequence:CCGGCTTATGCTTCAGGCAAAGAAACTCGAGTTTCTTTGCCTGAAGCATAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004569.3-452s21c1
Sequence:CCGGGTCAAGGATATTGTCATCAATCTCGAGATTGATGACAATATCCTTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004569.2-415s1c1
Sequence:CCGGGTCAAGGATATTGTCATCAATCTCGAGATTGATGACAATATCCTTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004569.3-356s21c1
Sequence:CCGGCAGGAGACTCTGTTAATCATTCTCGAGAATGATTAACAGAGTCTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004569
VALIDATED
PIGH MISSION shRNA Lentiviral Transduction Particles
phosphatidylinositol glycan anchor biosynthesis, class H
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000344434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004569.3-299s21c1
Sequence:CCGGGCCATCTTCATCACCCTCTTACTCGAGTAAGAGGGTGATGAAGATGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000344375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004569.3-388s21c1
Sequence:CCGGCATTCAGATGACTTCATCTTACTCGAGTAAGATGAAGTCATCTGAATGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000166029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004569.2-344s1c1
Sequence:CCGGCCCTTGGCATTCAGATGACTTCTCGAGAAGTCATCTGAATGCCAAGGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000158610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004569.2-351s1c1
Sequence:CCGGCATTCAGATGACTTCATCTTACTCGAGTAAGATGAAGTCATCTGAATGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000158641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004569.2-319s1c1
Sequence:CCGGCAGGAGACTCTGTTAATCATTCTCGAGAATGATTAACAGAGTCTCCTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000159483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004569.2-381s1c1
Sequence:CCGGCAAAGAAAGCACTACCTTCATCTCGAGATGAAGGTAGTGCTTTCTTTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000160154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004569.2-441s1c1
Sequence:CCGGCATTTACATGCAGAAGGTGATCTCGAGATCACCTTCTGCATGTAAATGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000160205    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004569.2-789s1c1
Sequence:CCGGCTCAGTATATTTCCGTGTATTCTCGAGAATACACGGAAATATACTGAGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000165263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004569.2-262s1c1
Sequence:CCGGGCCATCTTCATCACCCTCTTACTCGAGTAAGAGGGTGATGAAGATGGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000159516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004569.2-368s1c1
Sequence:CCGGCTTATGCTTCAGGCAAAGAAACTCGAGTTTCTTTGCCTGAAGCATAAGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000344436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004569.3-452s21c1
Sequence:CCGGGTCAAGGATATTGTCATCAATCTCGAGATTGATGACAATATCCTTGACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000159396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004569.2-415s1c1
Sequence:CCGGGTCAAGGATATTGTCATCAATCTCGAGATTGATGACAATATCCTTGACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000344374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004569.3-356s21c1
Sequence:CCGGCAGGAGACTCTGTTAATCATTCTCGAGAATGATTAACAGAGTCTCCTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029988
PIGH MISSION shRNA Bacterial Glycerol Stock
phosphatidylinositol glycan anchor biosynthesis, class H
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029988.1-300s1c1
Sequence:CCGGCTACTAATCATCGACTCACTTCTCGAGAAGTGAGTCGATGATTAGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029988.1-290s1c1
Sequence:CCGGCCAGGAGACTCTACTAATCATCTCGAGATGATTAGTAGAGTCTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029988.1-429s1c1
Sequence:CCGGGTCATTTACTACCTCTGCATTCTCGAGAATGCAGAGGTAGTAAATGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029988.1-395s1c1
Sequence:CCGGCATTATCATTAACGAGGCTATCTCGAGATAGCCTCGTTAATGATAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029988.1-257s1c1
Sequence:CCGGCCTGCTTGGTTACCTCCATTTCTCGAGAAATGGAGGTAACCAAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029988
PIGH MISSION shRNA shRNA Plasmid DNA
phosphatidylinositol glycan anchor biosynthesis, class H
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029988.1-300s1c1
Sequence:CCGGCTACTAATCATCGACTCACTTCTCGAGAAGTGAGTCGATGATTAGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029988.1-290s1c1
Sequence:CCGGCCAGGAGACTCTACTAATCATCTCGAGATGATTAGTAGAGTCTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029988.1-429s1c1
Sequence:CCGGGTCATTTACTACCTCTGCATTCTCGAGAATGCAGAGGTAGTAAATGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029988.1-395s1c1
Sequence:CCGGCATTATCATTAACGAGGCTATCTCGAGATAGCCTCGTTAATGATAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029988.1-257s1c1
Sequence:CCGGCCTGCTTGGTTACCTCCATTTCTCGAGAAATGGAGGTAACCAAGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029988
PIGH MISSION shRNA Lentiviral Transduction Particles
phosphatidylinositol glycan anchor biosynthesis, class H
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029988.1-300s1c1
Sequence:CCGGCTACTAATCATCGACTCACTTCTCGAGAAGTGAGTCGATGATTAGTAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000098794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029988.1-290s1c1
Sequence:CCGGCCAGGAGACTCTACTAATCATCTCGAGATGATTAGTAGAGTCTCCTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000098790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029988.1-429s1c1
Sequence:CCGGGTCATTTACTACCTCTGCATTCTCGAGAATGCAGAGGTAGTAAATGACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000098793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029988.1-395s1c1
Sequence:CCGGCATTATCATTAACGAGGCTATCTCGAGATAGCCTCGTTAATGATAATGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000098792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029988.1-257s1c1
Sequence:CCGGCCTGCTTGGTTACCTCCATTTCTCGAGAAATGGAGGTAACCAAGCAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???