EMAIL THIS PAGE TO A FRIEND

PIGK

phosphatidylinositol glycan anchor biosynthesis, class K

200 Gene Product Result for
Synonyms: GPI8
UniProtKB ID: Q92643, B2R7K3, O14822, Q5TG77
Gene ID:
Human(10026) Summary: This gene encodes a member of the cysteine protease family C13 that is involved in glycosylphosphatidylinositol (GPI)-anchor biosynthesis. The GPI-anchor is a glycolipid found on many blood cells and serves to anchor proteins to the cell surface. This protein is a member of the multisubunit enzyme, GPI transamidase and is thought to be its enzymatic component. GPI transamidase mediates GPI anchoring in the endoplasmic reticulum, by catalyzing the transfer of fully assembled GPI units to proteins. [provided by RefSeq, Jul 2008]
Mouse(329777) phosphatidylinositol glycan anchor biosynthesis, class K
Rat(295543) phosphatidylinositol glycan anchor biosynthesis, class K
Zebrafish(415239) phosphatidylinositol glycan, class K
domestic cat(101091799) phosphatidylinositol glycan anchor biosynthesis, class K
dog(479985) phosphatidylinositol glycan anchor biosynthesis, class K
chicken(424556) phosphatidylinositol glycan anchor biosynthesis, class K
cow(508700) phosphatidylinositol glycan anchor biosynthesis, class K
sheep(101121726) phosphatidylinositol glycan anchor biosynthesis, class K
domestic guinea pig(100715468) phosphatidylinositol glycan anchor biosynthesis, class K
naked mole-rat(101707296) phosphatidylinositol glycan anchor biosynthesis, class K
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005482 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005482 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005482 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025662 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025662 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025662 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU067551 MISSION® esiRNA esiRNA human PIGK (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005482 Rosetta Predictions human pricing
NM_001011953 Rosetta Predictions rat pricing
XM_575063 Rosetta Predictions rat pricing
NM_025662 Rosetta Predictions mouse pricing
NM_178016 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005482 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00090776 predicted 670
2 SASI_Hs01_00090777 predicted 256
3 SASI_Hs01_00090778 predicted 364
4 SASI_Hs01_00090779 predicted 326
5 SASI_Hs01_00090780 predicted 1160
6 SASI_Hs01_00090781 predicted 1193
7 SASI_Hs02_00339670 predicted 1005
8 SASI_Hs01_00090782 predicted 623
9 SASI_Hs01_00090783 predicted 691
10 SASI_Hs02_00339671 predicted 1162
11 SASI_Hs01_00090784 predicted 753
12 SASI_Hs01_00090785 predicted 443
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011953 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00047463 predicted 726
2 SASI_Rn01_00047464 predicted 241
3 SASI_Rn01_00047465 predicted 1169
4 SASI_Rn01_00047466 predicted 406
5 SASI_Rn01_00047467 predicted 659
6 SASI_Rn01_00047469 predicted 735
7 SASI_Rn02_00199968 predicted 747
8 SASI_Rn01_00047470 predicted 209
9 SASI_Rn01_00047471 predicted 465
10 SASI_Rn01_00047472 predicted 960
11 SASI_Rn01_00047468 predicted 310
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575063 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00145201 predicted 679
2 SASI_Rn01_00145202 predicted 546
3 SASI_Rn01_00145203 predicted 516
4 SASI_Rn01_00145204 predicted 610
5 SASI_Rn01_00145205 predicted 750
6 SASI_Rn01_00145206 predicted 509
7 SASI_Rn01_00145207 predicted 687
8 SASI_Rn01_00145208 predicted 593
9 SASI_Rn01_00145209 predicted 588
10 SASI_Rn01_00145210 predicted 448
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025662 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00149357 predicted 1456
2 SASI_Mm01_00149358 predicted 210
3 SASI_Mm01_00149359 predicted 1461
4 SASI_Mm01_00149360 predicted 1390
5 SASI_Mm01_00149361 predicted 1422
6 SASI_Mm01_00149362 predicted 1523
7 SASI_Mm01_00149363 predicted 226
8 SASI_Mm01_00149365 predicted 208
9 SASI_Mm01_00149366 predicted 983
10 SASI_Mm02_00328796 predicted 293
11 SASI_Mm01_00149364 predicted 1191
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178016 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00171754 predicted 1593
2 SASI_Mm01_00171755 predicted 205
3 SASI_Mm01_00171756 predicted 1598
4 SASI_Mm01_00171757 predicted 1525
5 SASI_Mm01_00171758 predicted 1569
6 SASI_Mm01_00171759 predicted 1658
7 SASI_Mm01_00171760 predicted 231
8 SASI_Mm01_00171762 predicted 212
9 SASI_Mm01_00171763 predicted 1119
10 SASI_Mm02_00348468 predicted 291
11 SASI_Mm01_00171761 predicted 1341
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005482
VALIDATED
PIGK MISSION shRNA Bacterial Glycerol Stock
phosphatidylinositol glycan anchor biosynthesis, class K
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000050118    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_005482.1-1382s1c1
Sequence:CCGGGCAACTGCTTAATGGCACTAACTCGAGTTAGTGCCATTAAGCAGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005482.1-283s1c1
Sequence:CCGGGCAGATGATATGGCCTGTAATCTCGAGATTACAGGCCATATCATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_005482.1-103s1c1
Sequence:CCGGGCTAGTCATATCGAGGATCAACTCGAGTTGATCCTCGATATGACTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_005482.1-607s1c1
Sequence:CCGGCGCTACAATGAGCTACTGTTTCTCGAGAAACAGTAGCTCATTGTAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_005482.1-1078s1c1
Sequence:CCGGGCTCAGATAATACACCAGAAACTCGAGTTTCTGGTGTATTATCTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288943    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_005482.2-1403s21c1
Sequence:CCGGGCAACTGCTTAATGGCACTAACTCGAGTTAGTGCCATTAAGCAGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_005482.2-628s21c1
Sequence:CCGGCGCTACAATGAGCTACTGTTTCTCGAGAAACAGTAGCTCATTGTAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_005482.2-304s21c1
Sequence:CCGGGCAGATGATATGGCCTGTAATCTCGAGATTACAGGCCATATCATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_005482.2-1099s21c1
Sequence:CCGGGCTCAGATAATACACCAGAAACTCGAGTTTCTGGTGTATTATCTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_005482.2-124s21c1
Sequence:CCGGGCTAGTCATATCGAGGATCAACTCGAGTTGATCCTCGATATGACTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005482
VALIDATED
PIGK MISSION shRNA shRNA Plasmid DNA
phosphatidylinositol glycan anchor biosynthesis, class K
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000050118    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_005482.1-1382s1c1
Sequence:CCGGGCAACTGCTTAATGGCACTAACTCGAGTTAGTGCCATTAAGCAGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005482.1-283s1c1
Sequence:CCGGGCAGATGATATGGCCTGTAATCTCGAGATTACAGGCCATATCATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_005482.1-103s1c1
Sequence:CCGGGCTAGTCATATCGAGGATCAACTCGAGTTGATCCTCGATATGACTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_005482.1-607s1c1
Sequence:CCGGCGCTACAATGAGCTACTGTTTCTCGAGAAACAGTAGCTCATTGTAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_005482.1-1078s1c1
Sequence:CCGGGCTCAGATAATACACCAGAAACTCGAGTTTCTGGTGTATTATCTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288943    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_005482.2-1403s21c1
Sequence:CCGGGCAACTGCTTAATGGCACTAACTCGAGTTAGTGCCATTAAGCAGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_005482.2-628s21c1
Sequence:CCGGCGCTACAATGAGCTACTGTTTCTCGAGAAACAGTAGCTCATTGTAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_005482.2-304s21c1
Sequence:CCGGGCAGATGATATGGCCTGTAATCTCGAGATTACAGGCCATATCATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_005482.2-1099s21c1
Sequence:CCGGGCTCAGATAATACACCAGAAACTCGAGTTTCTGGTGTATTATCTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_005482.2-124s21c1
Sequence:CCGGGCTAGTCATATCGAGGATCAACTCGAGTTGATCCTCGATATGACTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005482
VALIDATED
PIGK MISSION shRNA Lentiviral Transduction Particles
phosphatidylinositol glycan anchor biosynthesis, class K
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000050118    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_005482.1-1382s1c1
Sequence:CCGGGCAACTGCTTAATGGCACTAACTCGAGTTAGTGCCATTAAGCAGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005482.1-283s1c1
Sequence:CCGGGCAGATGATATGGCCTGTAATCTCGAGATTACAGGCCATATCATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_005482.1-103s1c1
Sequence:CCGGGCTAGTCATATCGAGGATCAACTCGAGTTGATCCTCGATATGACTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_005482.1-607s1c1
Sequence:CCGGCGCTACAATGAGCTACTGTTTCTCGAGAAACAGTAGCTCATTGTAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_005482.1-1078s1c1
Sequence:CCGGGCTCAGATAATACACCAGAAACTCGAGTTTCTGGTGTATTATCTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288943    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_005482.2-1403s21c1
Sequence:CCGGGCAACTGCTTAATGGCACTAACTCGAGTTAGTGCCATTAAGCAGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_005482.2-628s21c1
Sequence:CCGGCGCTACAATGAGCTACTGTTTCTCGAGAAACAGTAGCTCATTGTAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_005482.2-304s21c1
Sequence:CCGGGCAGATGATATGGCCTGTAATCTCGAGATTACAGGCCATATCATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_005482.2-1099s21c1
Sequence:CCGGGCTCAGATAATACACCAGAAACTCGAGTTTCTGGTGTATTATCTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_005482.2-124s21c1
Sequence:CCGGGCTAGTCATATCGAGGATCAACTCGAGTTGATCCTCGATATGACTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025662
VALIDATED
PIGK MISSION shRNA Bacterial Glycerol Stock
phosphatidylinositol glycan anchor biosynthesis, class K
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000018421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025662.3-660s1c1
Sequence:CCGGGCGGTTCTACTCTCCTAACATCTCGAGATGTTAGGAGAGTAGAACCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025662.3-145s1c1
Sequence:CCGGCACACAAATAACTGGGCTGTTCTCGAGAACAGCCCAGTTATTTGTGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025662.3-1158s1c1
Sequence:CCGGCATGGTCTTCTTCAAGACCTACTCGAGTAGGTCTTGAAGAAGACCATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025662.3-333s1c1
Sequence:CCGGCCACAAGAACATGGAGCTCAACTCGAGTTGAGCTCCATGTTCTTGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025662.3-736s1c1
Sequence:CCGGCCTGCGATTGGAGTTCATCTTCTCGAGAAGATGAACTCCAATCGCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025662.4-1172s21c1
Sequence:CCGGCATGGTCTTCTTCAAGACCTACTCGAGTAGGTCTTGAAGAAGACCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025662.4-159s21c1
Sequence:CCGGCACACAAATAACTGGGCTGTTCTCGAGAACAGCCCAGTTATTTGTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025662.4-347s21c1
Sequence:CCGGCCACAAGAACATGGAGCTCAACTCGAGTTGAGCTCCATGTTCTTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025662.4-674s21c1
Sequence:CCGGGCGGTTCTACTCTCCTAACATCTCGAGATGTTAGGAGAGTAGAACCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025662.4-750s21c1
Sequence:CCGGCCTGCGATTGGAGTTCATCTTCTCGAGAAGATGAACTCCAATCGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025662
VALIDATED
PIGK MISSION shRNA shRNA Plasmid DNA
phosphatidylinositol glycan anchor biosynthesis, class K
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000018421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025662.3-660s1c1
Sequence:CCGGGCGGTTCTACTCTCCTAACATCTCGAGATGTTAGGAGAGTAGAACCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025662.3-145s1c1
Sequence:CCGGCACACAAATAACTGGGCTGTTCTCGAGAACAGCCCAGTTATTTGTGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025662.3-1158s1c1
Sequence:CCGGCATGGTCTTCTTCAAGACCTACTCGAGTAGGTCTTGAAGAAGACCATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025662.3-333s1c1
Sequence:CCGGCCACAAGAACATGGAGCTCAACTCGAGTTGAGCTCCATGTTCTTGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025662.3-736s1c1
Sequence:CCGGCCTGCGATTGGAGTTCATCTTCTCGAGAAGATGAACTCCAATCGCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025662.4-1172s21c1
Sequence:CCGGCATGGTCTTCTTCAAGACCTACTCGAGTAGGTCTTGAAGAAGACCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025662.4-159s21c1
Sequence:CCGGCACACAAATAACTGGGCTGTTCTCGAGAACAGCCCAGTTATTTGTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025662.4-347s21c1
Sequence:CCGGCCACAAGAACATGGAGCTCAACTCGAGTTGAGCTCCATGTTCTTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025662.4-674s21c1
Sequence:CCGGGCGGTTCTACTCTCCTAACATCTCGAGATGTTAGGAGAGTAGAACCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025662.4-750s21c1
Sequence:CCGGCCTGCGATTGGAGTTCATCTTCTCGAGAAGATGAACTCCAATCGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025662
VALIDATED
PIGK MISSION shRNA Lentiviral Transduction Particles
phosphatidylinositol glycan anchor biosynthesis, class K
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000018421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025662.3-660s1c1
Sequence:CCGGGCGGTTCTACTCTCCTAACATCTCGAGATGTTAGGAGAGTAGAACCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025662.3-145s1c1
Sequence:CCGGCACACAAATAACTGGGCTGTTCTCGAGAACAGCCCAGTTATTTGTGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025662.3-1158s1c1
Sequence:CCGGCATGGTCTTCTTCAAGACCTACTCGAGTAGGTCTTGAAGAAGACCATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025662.3-333s1c1
Sequence:CCGGCCACAAGAACATGGAGCTCAACTCGAGTTGAGCTCCATGTTCTTGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025662.3-736s1c1
Sequence:CCGGCCTGCGATTGGAGTTCATCTTCTCGAGAAGATGAACTCCAATCGCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025662.4-1172s21c1
Sequence:CCGGCATGGTCTTCTTCAAGACCTACTCGAGTAGGTCTTGAAGAAGACCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025662.4-159s21c1
Sequence:CCGGCACACAAATAACTGGGCTGTTCTCGAGAACAGCCCAGTTATTTGTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025662.4-347s21c1
Sequence:CCGGCCACAAGAACATGGAGCTCAACTCGAGTTGAGCTCCATGTTCTTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025662.4-674s21c1
Sequence:CCGGGCGGTTCTACTCTCCTAACATCTCGAGATGTTAGGAGAGTAGAACCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025662.4-750s21c1
Sequence:CCGGCCTGCGATTGGAGTTCATCTTCTCGAGAAGATGAACTCCAATCGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)