EMAIL THIS PAGE TO A FRIEND

PIGL

phosphatidylinositol glycan anchor biosynthesis, class L

60 Gene Product Result for
Synonyms: CHIME
UniProtKB ID: Q9Y2B2, A8KA67
Gene ID:
Human(9487) Summary: This gene encodes an enzyme that catalyzes the second step of glycosylphosphatidylinositol (GPI) biosynthesis, which is the de-N-acetylation of N-acetylglucosaminylphosphatidylinositol (GlcNAc-PI). Study of a similar rat enzyme suggests that this protein localizes to the endoplasmic reticulum. [provided by RefSeq, Jul 2008]
Mouse(327942) phosphatidylinositol glycan anchor biosynthesis, class L
Rat(192263) phosphatidylinositol glycan anchor biosynthesis, class L
naked mole-rat(101703262) phosphatidylinositol glycan anchor biosynthesis, class L
domestic guinea pig(100728121) phosphatidylinositol glycan anchor biosynthesis, class L
cow(507080) phosphatidylinositol glycan anchor biosynthesis, class L
sheep(101117518) phosphatidylinositol glycan anchor biosynthesis, class L
Zebrafish(561471) phosphatidylinositol glycan anchor biosynthesis, class L
chicken(417600) phosphatidylinositol glycan anchor biosynthesis, class L
domestic cat(101095055) phosphatidylinositol glycan anchor biosynthesis, class L
dog(479514) phosphatidylinositol glycan anchor biosynthesis, class L
Gene Class: Deacetylase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004278 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004278 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004278 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_199026 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_199026 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_199026 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004278 Rosetta Predictions human pricing
NM_138901 Rosetta Predictions rat pricing
NM_001039536 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004278 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00119377 predicted 438
2 SASI_Hs01_00119378 predicted 251
3 SASI_Hs01_00119379 predicted 523
4 SASI_Hs01_00119380 predicted 335
5 SASI_Hs01_00119381 predicted 535
6 SASI_Hs01_00119382 predicted 686
7 SASI_Hs01_00119383 predicted 283
8 SASI_Hs01_00119385 predicted 367
9 SASI_Hs01_00119386 predicted 331
10 SASI_Hs02_00337262 predicted 409
11 SASI_Hs01_00119384 predicted 530
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138901 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00072588 predicted 245
2 SASI_Rn02_00268365 predicted 451
3 SASI_Rn01_00072591 predicted 307
4 SASI_Rn02_00268366 predicted 994
5 SASI_Rn02_00268367 predicted 527
6 SASI_Rn02_00268368 predicted 464
7 SASI_Rn02_00268369 predicted 1103
8 SASI_Rn02_00268370 predicted 1163
9 SASI_Rn02_00268371 predicted 457
10 SASI_Rn02_00268372 predicted 566
11 SASI_Rn01_00072589 predicted 708
12 SASI_Rn01_00072590 predicted 1636
13 SASI_Rn01_00072592 predicted 729
14 SASI_Rn01_00072593 predicted 1350
15 SASI_Rn01_00072594 predicted 556
16 SASI_Rn01_00072595 predicted 942
17 SASI_Rn01_00072596 predicted 1606
18 SASI_Rn01_00072597 predicted 1639
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039536 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00134648 predicted 1038
2 SASI_Mm01_00134649 predicted 546
3 SASI_Mm01_00134650 predicted 307
4 SASI_Mm01_00134651 predicted 297
5 SASI_Mm01_00134652 predicted 1063
6 SASI_Mm01_00134653 predicted 238
7 SASI_Mm01_00134654 predicted 987
8 SASI_Mm01_00134655 predicted 260
9 SASI_Mm01_00134656 predicted 1048
10 SASI_Mm01_00134657 predicted 1231
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004278
VALIDATED
PIGL MISSION shRNA Bacterial Glycerol Stock
phosphatidylinositol glycan anchor biosynthesis, class L
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000294171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004278.3-537s21c1
Sequence:CCGGTCAGAAGGGAAGTTACCTAAACTCGAGTTTAGGTAACTTCCCTTCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004278.3-496s21c1
Sequence:CCGGGCAATCACATTGCTCTGTATGCTCGAGCATACAGAGCAATGTGATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294170    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004278.3-856s21c1
Sequence:CCGGTGGCCTGGCACTGGCTTATTTCTCGAGAAATAAGCCAGTGCCAGGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004278.2-399s1c1
Sequence:CCGGCTTCAGCACATAGAAGTGAATCTCGAGATTCACTTCTATGTGCTGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004278.2-725s1c1
Sequence:CCGGCTCCCGGTACATGAGAATCAACTCGAGTTGATTCTCATGTACCGGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004278.2-603s1c1
Sequence:CCGGTCTCTGCTTCATACGCAGGATCTCGAGATCCTGCGTATGAAGCAGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004278.3-288s21c1
Sequence:CCGGGAGACTCGTAAGAAAGAACTTCTCGAGAAGTTCTTTCTTACGAGTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004278.2-261s1c1
Sequence:CCGGGAGACTCGTAAGAAAGAACTTCTCGAGAAGTTCTTTCTTACGAGTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004278.3-353s21c1
Sequence:CCGGGATTATTGACAACAGGGATTTCTCGAGAAATCCCTGTTGTCAATAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004278.2-326s1c1
Sequence:CCGGGATTATTGACAACAGGGATTTCTCGAGAAATCCCTGTTGTCAATAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004278
VALIDATED
PIGL MISSION shRNA shRNA Plasmid DNA
phosphatidylinositol glycan anchor biosynthesis, class L
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000294171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004278.3-537s21c1
Sequence:CCGGTCAGAAGGGAAGTTACCTAAACTCGAGTTTAGGTAACTTCCCTTCTGATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000294169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004278.3-496s21c1
Sequence:CCGGGCAATCACATTGCTCTGTATGCTCGAGCATACAGAGCAATGTGATTGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000294170    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004278.3-856s21c1
Sequence:CCGGTGGCCTGGCACTGGCTTATTTCTCGAGAAATAAGCCAGTGCCAGGCCATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000051503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004278.2-399s1c1
Sequence:CCGGCTTCAGCACATAGAAGTGAATCTCGAGATTCACTTCTATGTGCTGAAGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000051504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004278.2-725s1c1
Sequence:CCGGCTCCCGGTACATGAGAATCAACTCGAGTTGATTCTCATGTACCGGGAGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000051507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004278.2-603s1c1
Sequence:CCGGTCTCTGCTTCATACGCAGGATCTCGAGATCCTGCGTATGAAGCAGAGATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000286849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004278.3-288s21c1
Sequence:CCGGGAGACTCGTAAGAAAGAACTTCTCGAGAAGTTCTTTCTTACGAGTCTCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000051505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004278.2-261s1c1
Sequence:CCGGGAGACTCGTAAGAAAGAACTTCTCGAGAAGTTCTTTCTTACGAGTCTCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000286769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004278.3-353s21c1
Sequence:CCGGGATTATTGACAACAGGGATTTCTCGAGAAATCCCTGTTGTCAATAATCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000051506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004278.2-326s1c1
Sequence:CCGGGATTATTGACAACAGGGATTTCTCGAGAAATCCCTGTTGTCAATAATCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004278
VALIDATED
PIGL MISSION shRNA Lentiviral Transduction Particles
phosphatidylinositol glycan anchor biosynthesis, class L
Human
10 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000294171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004278.3-537s21c1
Sequence:CCGGTCAGAAGGGAAGTTACCTAAACTCGAGTTTAGGTAACTTCCCTTCTGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004278.3-496s21c1
Sequence:CCGGGCAATCACATTGCTCTGTATGCTCGAGCATACAGAGCAATGTGATTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294170    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004278.3-856s21c1
Sequence:CCGGTGGCCTGGCACTGGCTTATTTCTCGAGAAATAAGCCAGTGCCAGGCCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004278.2-399s1c1
Sequence:CCGGCTTCAGCACATAGAAGTGAATCTCGAGATTCACTTCTATGTGCTGAAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004278.2-725s1c1
Sequence:CCGGCTCCCGGTACATGAGAATCAACTCGAGTTGATTCTCATGTACCGGGAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004278.2-603s1c1
Sequence:CCGGTCTCTGCTTCATACGCAGGATCTCGAGATCCTGCGTATGAAGCAGAGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004278.3-288s21c1
Sequence:CCGGGAGACTCGTAAGAAAGAACTTCTCGAGAAGTTCTTTCTTACGAGTCTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004278.2-261s1c1
Sequence:CCGGGAGACTCGTAAGAAAGAACTTCTCGAGAAGTTCTTTCTTACGAGTCTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004278.3-353s21c1
Sequence:CCGGGATTATTGACAACAGGGATTTCTCGAGAAATCCCTGTTGTCAATAATCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004278.2-326s1c1
Sequence:CCGGGATTATTGACAACAGGGATTTCTCGAGAAATCCCTGTTGTCAATAATCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199026
PIGL MISSION shRNA Bacterial Glycerol Stock
phosphatidylinositol glycan anchor biosynthesis, class L
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093739    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199026.1-817s1c1
Sequence:CCGGCCAGAAATTATTGCTGTCATACTCGAGTATGACAGCAATAATTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199026.1-312s1c1
Sequence:CCGGCCGTGTAATGATTATTGACAACTCGAGTTGTCAATAATCATTACACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199026.1-462s1c1
Sequence:CCGGCAGCAACCATATTGCTTTGTACTCGAGTACAAAGCAATATGGTTGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199026.1-735s1c1
Sequence:CCGGCCTCTATAAGGCTCCCATGTACTCGAGTACATGGGAGCCTTATAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199026.1-465s1c1
Sequence:CCGGCAACCATATTGCTTTGTACAACTCGAGTTGTACAAAGCAATATGGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199026
PIGL MISSION shRNA shRNA Plasmid DNA
phosphatidylinositol glycan anchor biosynthesis, class L
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093739    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199026.1-817s1c1
Sequence:CCGGCCAGAAATTATTGCTGTCATACTCGAGTATGACAGCAATAATTTCTGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000093740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199026.1-312s1c1
Sequence:CCGGCCGTGTAATGATTATTGACAACTCGAGTTGTCAATAATCATTACACGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000093741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199026.1-462s1c1
Sequence:CCGGCAGCAACCATATTGCTTTGTACTCGAGTACAAAGCAATATGGTTGCTGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000093743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199026.1-735s1c1
Sequence:CCGGCCTCTATAAGGCTCCCATGTACTCGAGTACATGGGAGCCTTATAGAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000093742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199026.1-465s1c1
Sequence:CCGGCAACCATATTGCTTTGTACAACTCGAGTTGTACAAAGCAATATGGTTGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199026
PIGL MISSION shRNA Lentiviral Transduction Particles
phosphatidylinositol glycan anchor biosynthesis, class L
Mouse
5 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000093739    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199026.1-817s1c1
Sequence:CCGGCCAGAAATTATTGCTGTCATACTCGAGTATGACAGCAATAATTTCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199026.1-312s1c1
Sequence:CCGGCCGTGTAATGATTATTGACAACTCGAGTTGTCAATAATCATTACACGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199026.1-462s1c1
Sequence:CCGGCAGCAACCATATTGCTTTGTACTCGAGTACAAAGCAATATGGTTGCTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199026.1-735s1c1
Sequence:CCGGCCTCTATAAGGCTCCCATGTACTCGAGTACATGGGAGCCTTATAGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199026.1-465s1c1
Sequence:CCGGCAACCATATTGCTTTGTACAACTCGAGTTGTACAAAGCAATATGGTTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)