EMAIL THIS PAGE TO A FRIEND

PIGM

phosphatidylinositol glycan anchor biosynthesis, class M

151 Gene Product Result for
Synonyms: GPI-MT-I
UniProtKB ID: Q9H3S5
Gene ID:
Human(93183) Summary: This gene encodes a transmembrane protein that is located in the endoplasmic reticulum and is involved in GPI-anchor biosynthesis. The glycosylphosphatidylinositol (GPI)-anchor is a glycolipid which contains three mannose molecules in its core backbone. The GPI-anchor is found on many blood cells and serves to anchor proteins to the cell surface. This gene encodes a mannosyltransferase, GPI-MT-I, that transfers the first mannose to GPI on the lumenal side of the endoplasmic reticulum. [provided by RefSeq, Jul 2008]
Mouse(67556) phosphatidylinositol glycan anchor biosynthesis, class M
Rat(79112) phosphatidylinositol glycan anchor biosynthesis, class M
Zebrafish(393361) phosphatidylinositol glycan anchor biosynthesis, class M
Horse(100058075) phosphatidylinositol glycan anchor biosynthesis, class M
domestic cat(101097541) phosphatidylinositol glycan anchor biosynthesis, class M
chicken(428583) phosphatidylinositol glycan anchor biosynthesis, class M
dog(610166) phosphatidylinositol glycan anchor biosynthesis, class M
cow(509680) phosphatidylinositol glycan anchor biosynthesis, class M
sheep(101117633) phosphatidylinositol glycan anchor biosynthesis, class M
domestic guinea pig(100728687) phosphatidylinositol glycan anchor biosynthesis, class M
naked mole-rat(101724721) phosphatidylinositol glycan anchor biosynthesis, class M
Domestic Rabbit(100342208) phosphatidylinositol glycan anchor biosynthesis, class M
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026234 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026234 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026234 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_145167 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145167 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145167 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145167 Rosetta Predictions human pricing
NM_024144 Rosetta Predictions rat pricing
NM_026234 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145167 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00092637 predicted 1446
2 SASI_Hs01_00092638 predicted 1335
3 SASI_Hs01_00092639 predicted 1391
4 SASI_Hs01_00092640 predicted 1561
5 SASI_Hs01_00092641 predicted 863
6 SASI_Hs01_00092642 predicted 1039
7 SASI_Hs01_00092643 predicted 890
8 SASI_Hs01_00092644 predicted 1496
9 SASI_Hs01_00092645 predicted 1278
10 SASI_Hs01_00092646 predicted 1070
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024144 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00041095 predicted 1330
2 SASI_Rn01_00041096 predicted 1208
3 SASI_Rn02_00263869 predicted 1213
4 SASI_Rn02_00263870 predicted 1225
5 SASI_Rn02_00263871 predicted 722
6 SASI_Rn01_00041098 predicted 552
7 SASI_Rn01_00041099 predicted 1171
8 SASI_Rn01_00041100 predicted 1198
9 SASI_Rn01_00041101 predicted 893
10 SASI_Rn01_00041103 predicted 221
11 SASI_Rn01_00041097 predicted 1262
12 SASI_Rn01_00041102 predicted 1212
13 SASI_Rn01_00041104 predicted 778
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026234 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00029890 predicted 1283
2 SASI_Mm01_00029892 predicted 1365
3 SASI_Mm01_00029893 predicted 1255
4 SASI_Mm01_00029894 predicted 870
5 SASI_Mm02_00329916 predicted 963
6 SASI_Mm01_00029895 predicted 311
7 SASI_Mm01_00029896 predicted 982
8 SASI_Mm02_00329917 predicted 1523
9 SASI_Mm01_00029897 predicted 1377
10 SASI_Mm01_00029898 predicted 1241
11 SASI_Mm01_00029891 predicted 1497
12 SASI_Mm01_00029899 predicted 1070
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026234
VALIDATED
PIGM MISSION shRNA Bacterial Glycerol Stock
phosphatidylinositol glycan anchor biosynthesis, class M
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000099592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026234.2-1264s1c1
Sequence:CCGGCCTGCATATGTTCTAGAGTTTCTCGAGAAACTCTAGAACATATGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026234.2-961s1c1
Sequence:CCGGCCGTACTTCTATATGCTGTATCTCGAGATACAGCATATAGAAGTACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099590    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026234.2-3642s1c1
Sequence:CCGGCGCTTCTGTTATTCCACCTTTCTCGAGAAAGGTGGAATAACAGAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026234.2-1389s1c1
Sequence:CCGGCCTAACGGAGAGAATCAAATACTCGAGTATTTGATTCTCTCCGTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026234.2-947s1c1
Sequence:CCGGGCCATAATTTCTCTCCGTACTCTCGAGAGTACGGAGAGAAATTATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026234.4-1288s21c1
Sequence:CCGGCCTGCATATGTTCTAGAGTTTCTCGAGAAACTCTAGAACATATGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026234.4-1373s21c1
Sequence:CCGGCCATACTGATTCAGATTATTTCTCGAGAAATAATCTGAATCAGTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305206    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026234.4-1891s21c1
Sequence:CCGGTCGGTTGGGAAAGTCTGAAATCTCGAGATTTCAGACTTTCCCAACCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026234.4-299s21c1
Sequence:CCGGTGGTGAGGTACACCGACATAGCTCGAGCTATGTCGGTGTACCTCACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026234.4-1413s21c1
Sequence:CCGGCCTAACGGAGAGAATCAAATACTCGAGTATTTGATTCTCTCCGTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026234
VALIDATED
PIGM MISSION shRNA shRNA Plasmid DNA
phosphatidylinositol glycan anchor biosynthesis, class M
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000099592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026234.2-1264s1c1
Sequence:CCGGCCTGCATATGTTCTAGAGTTTCTCGAGAAACTCTAGAACATATGCAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000099591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026234.2-961s1c1
Sequence:CCGGCCGTACTTCTATATGCTGTATCTCGAGATACAGCATATAGAAGTACGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000099590    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026234.2-3642s1c1
Sequence:CCGGCGCTTCTGTTATTCCACCTTTCTCGAGAAAGGTGGAATAACAGAAGCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000099593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026234.2-1389s1c1
Sequence:CCGGCCTAACGGAGAGAATCAAATACTCGAGTATTTGATTCTCTCCGTTAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000099594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026234.2-947s1c1
Sequence:CCGGGCCATAATTTCTCTCCGTACTCTCGAGAGTACGGAGAGAAATTATGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000309130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026234.4-1288s21c1
Sequence:CCGGCCTGCATATGTTCTAGAGTTTCTCGAGAAACTCTAGAACATATGCAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000305205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026234.4-1373s21c1
Sequence:CCGGCCATACTGATTCAGATTATTTCTCGAGAAATAATCTGAATCAGTATGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000305206    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026234.4-1891s21c1
Sequence:CCGGTCGGTTGGGAAAGTCTGAAATCTCGAGATTTCAGACTTTCCCAACCGATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000305204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026234.4-299s21c1
Sequence:CCGGTGGTGAGGTACACCGACATAGCTCGAGCTATGTCGGTGTACCTCACCATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000309133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026234.4-1413s21c1
Sequence:CCGGCCTAACGGAGAGAATCAAATACTCGAGTATTTGATTCTCTCCGTTAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026234
VALIDATED
PIGM MISSION shRNA Lentiviral Transduction Particles
phosphatidylinositol glycan anchor biosynthesis, class M
Mouse
10 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000099592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026234.2-1264s1c1
Sequence:CCGGCCTGCATATGTTCTAGAGTTTCTCGAGAAACTCTAGAACATATGCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026234.2-961s1c1
Sequence:CCGGCCGTACTTCTATATGCTGTATCTCGAGATACAGCATATAGAAGTACGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099590    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026234.2-3642s1c1
Sequence:CCGGCGCTTCTGTTATTCCACCTTTCTCGAGAAAGGTGGAATAACAGAAGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026234.2-1389s1c1
Sequence:CCGGCCTAACGGAGAGAATCAAATACTCGAGTATTTGATTCTCTCCGTTAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026234.2-947s1c1
Sequence:CCGGGCCATAATTTCTCTCCGTACTCTCGAGAGTACGGAGAGAAATTATGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026234.4-1288s21c1
Sequence:CCGGCCTGCATATGTTCTAGAGTTTCTCGAGAAACTCTAGAACATATGCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026234.4-1373s21c1
Sequence:CCGGCCATACTGATTCAGATTATTTCTCGAGAAATAATCTGAATCAGTATGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305206    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026234.4-1891s21c1
Sequence:CCGGTCGGTTGGGAAAGTCTGAAATCTCGAGATTTCAGACTTTCCCAACCGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026234.4-299s21c1
Sequence:CCGGTGGTGAGGTACACCGACATAGCTCGAGCTATGTCGGTGTACCTCACCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026234.4-1413s21c1
Sequence:CCGGCCTAACGGAGAGAATCAAATACTCGAGTATTTGATTCTCTCCGTTAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145167
PIGM MISSION shRNA Bacterial Glycerol Stock
phosphatidylinositol glycan anchor biosynthesis, class M
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000230294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145167.2-1454s21c1
Sequence:CCGGTTGTTCCATCCTGATTCAAATCTCGAGATTTGAATCAGGATGGAACAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145167.2-720s21c1
Sequence:GTACCGGATGGTCCTCTACTTGATAAAGCTCGAGCTTTATCAAGTAGAGGACCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145167.1-1036s1c1
Sequence:CCGGCCGTACTTCTACATGCTGTATCTCGAGATACAGCATGTAGAAGTACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158794    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145167.1-1511s1c1
Sequence:CCGGGCTACTGTGTTACATTCTGATCTCGAGATCAGAATGTAACACAGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230295    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145167.2-2675s21c1
Sequence:CCGGAGTGGTATTAGACTGCTATTTCTCGAGAAATAGCAGTCTAATACCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145167.1-1506s1c1
Sequence:CCGGCCTCTGCTACTGTGTTACATTCTCGAGAATGTAACACAGTAGCAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145167.2-681s21c1
Sequence:CCGGCGCGGTAATGCGGACTCTATTCTCGAGAATAGAGTCCGCATTACCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145167.1-1127s1c1
Sequence:CCGGCAGCTGTGTCTTTCGCCTATTCTCGAGAATAGGCGAAAGACACAGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145167.1-745s1c1
Sequence:CCGGGCGGTGCATATGAAGATATATCTCGAGATATATCTTCATATGCACCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158920    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145167.1-1603s1c1
Sequence:CCGGCCATGTTCCAACAGAACTTAACTCGAGTTAAGTTCTGTTGGAACATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145167.1-495s1c1
Sequence:CCGGGCTCTTTGGAAAGTTTCTCTTCTCGAGAAGAGAAACTTTCCAAAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145167.1-531s1c1
Sequence:CCGGCCTCACCGCTTTCCTCTTATACTCGAGTATAAGAGGAAAGCGGTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145167.2-1163s21c1
Sequence:CCGGAGCTGTGTCTTTCGCCTATTACTCGAGTAATAGGCGAAAGACACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145167
PIGM MISSION shRNA shRNA Plasmid DNA
phosphatidylinositol glycan anchor biosynthesis, class M
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000230294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145167.2-1454s21c1
Sequence:CCGGTTGTTCCATCCTGATTCAAATCTCGAGATTTGAATCAGGATGGAACAATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000218600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145167.2-720s21c1
Sequence:GTACCGGATGGTCCTCTACTTGATAAAGCTCGAGCTTTATCAAGTAGAGGACCATTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000162678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145167.1-1036s1c1
Sequence:CCGGCCGTACTTCTACATGCTGTATCTCGAGATACAGCATGTAGAAGTACGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000158794    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145167.1-1511s1c1
Sequence:CCGGGCTACTGTGTTACATTCTGATCTCGAGATCAGAATGTAACACAGTAGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000230295    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145167.2-2675s21c1
Sequence:CCGGAGTGGTATTAGACTGCTATTTCTCGAGAAATAGCAGTCTAATACCACTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000162716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145167.1-1506s1c1
Sequence:CCGGCCTCTGCTACTGTGTTACATTCTCGAGAATGTAACACAGTAGCAGAGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000230293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145167.2-681s21c1
Sequence:CCGGCGCGGTAATGCGGACTCTATTCTCGAGAATAGAGTCCGCATTACCGCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000165792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145167.1-1127s1c1
Sequence:CCGGCAGCTGTGTCTTTCGCCTATTCTCGAGAATAGGCGAAAGACACAGCTGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000159433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145167.1-745s1c1
Sequence:CCGGGCGGTGCATATGAAGATATATCTCGAGATATATCTTCATATGCACCGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000158920    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145167.1-1603s1c1
Sequence:CCGGCCATGTTCCAACAGAACTTAACTCGAGTTAAGTTCTGTTGGAACATGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000159826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145167.1-495s1c1
Sequence:CCGGGCTCTTTGGAAAGTTTCTCTTCTCGAGAAGAGAAACTTTCCAAAGAGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000166582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145167.1-531s1c1
Sequence:CCGGCCTCACCGCTTTCCTCTTATACTCGAGTATAAGAGGAAAGCGGTGAGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000257148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145167.2-1163s21c1
Sequence:CCGGAGCTGTGTCTTTCGCCTATTACTCGAGTAATAGGCGAAAGACACAGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145167
PIGM MISSION shRNA Lentiviral Transduction Particles
phosphatidylinositol glycan anchor biosynthesis, class M
Human
13 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000230294    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145167.2-1454s21c1
Sequence:CCGGTTGTTCCATCCTGATTCAAATCTCGAGATTTGAATCAGGATGGAACAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145167.2-720s21c1
Sequence:GTACCGGATGGTCCTCTACTTGATAAAGCTCGAGCTTTATCAAGTAGAGGACCATTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145167.1-1036s1c1
Sequence:CCGGCCGTACTTCTACATGCTGTATCTCGAGATACAGCATGTAGAAGTACGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158794    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145167.1-1511s1c1
Sequence:CCGGGCTACTGTGTTACATTCTGATCTCGAGATCAGAATGTAACACAGTAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230295    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145167.2-2675s21c1
Sequence:CCGGAGTGGTATTAGACTGCTATTTCTCGAGAAATAGCAGTCTAATACCACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145167.1-1506s1c1
Sequence:CCGGCCTCTGCTACTGTGTTACATTCTCGAGAATGTAACACAGTAGCAGAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145167.2-681s21c1
Sequence:CCGGCGCGGTAATGCGGACTCTATTCTCGAGAATAGAGTCCGCATTACCGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145167.1-1127s1c1
Sequence:CCGGCAGCTGTGTCTTTCGCCTATTCTCGAGAATAGGCGAAAGACACAGCTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145167.1-745s1c1
Sequence:CCGGGCGGTGCATATGAAGATATATCTCGAGATATATCTTCATATGCACCGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158920    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145167.1-1603s1c1
Sequence:CCGGCCATGTTCCAACAGAACTTAACTCGAGTTAAGTTCTGTTGGAACATGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145167.1-495s1c1
Sequence:CCGGGCTCTTTGGAAAGTTTCTCTTCTCGAGAAGAGAAACTTTCCAAAGAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145167.1-531s1c1
Sequence:CCGGCCTCACCGCTTTCCTCTTATACTCGAGTATAAGAGGAAAGCGGTGAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145167.2-1163s21c1
Sequence:CCGGAGCTGTGTCTTTCGCCTATTACTCGAGTAATAGGCGAAAGACACAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)