EMAIL THIS PAGE TO A FRIEND

PIGN

phosphatidylinositol glycan anchor biosynthesis, class N

125 Gene Product Result for
Synonyms: MCAHS MCAHS1 MCD4 MDC4 PIG-N
UniProtKB ID: O95427, Q7L8F8, Q8TC01, Q9NT05
Gene ID:
Human(23556) Summary: This gene encodes a protein that is involved in glycosylphosphatidylinositol (GPI)-anchor biosynthesis. The GPI-anchor is a glycolipid found on many blood cells and serves to anchor proteins to the cell surface. This protein is expressed in the endoplasmic reticulum and transfers phosphoethanolamine (EtNP) to the first mannose of the GPI anchor. Two alternatively spliced variants, which encode an identical isoform, have been reported. [provided by RefSeq, Jul 2008]
Mouse(27392) phosphatidylinositol glycan anchor biosynthesis, class N
Rat(309051) phosphatidylinositol glycan anchor biosynthesis, class N
Domestic Rabbit(100357388) phosphatidylinositol glycan anchor biosynthesis, class N
naked mole-rat(101698299) phosphatidylinositol glycan anchor biosynthesis, class N
domestic guinea pig(100724676) phosphatidylinositol glycan anchor biosynthesis, class N
cow(525095) phosphatidylinositol glycan anchor biosynthesis, class N
sheep(101118324) phosphatidylinositol glycan anchor biosynthesis, class N
Zebrafish(556797) phosphatidylinositol glycan anchor biosynthesis, class N
chicken(420908) phosphatidylinositol glycan anchor biosynthesis, class N
dog(476182) phosphatidylinositol glycan anchor biosynthesis, class N
Horse(100050704) phosphatidylinositol glycan anchor biosynthesis, class N
domestic cat(101082599) phosphatidylinositol glycan anchor biosynthesis, class N
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012327 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012327 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012327 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013784 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013784 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013784 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU017311 MISSION® esiRNA targeting mouse Pign mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012327 Rosetta Predictions human pricing
NM_176787 Rosetta Predictions human pricing
XM_001055659 Rosetta Predictions rat pricing
XM_219411 Rosetta Predictions rat pricing
NM_013784 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012327 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00344115 predicted 2262
2 SASI_Hs01_00163147 predicted 1912
3 SASI_Hs01_00163149 predicted 2312
4 SASI_Hs01_00163150 predicted 1356
5 SASI_Hs01_00163151 predicted 2522
6 SASI_Hs01_00163152 predicted 1038
7 SASI_Hs01_00163154 predicted 2652
8 SASI_Hs01_00163155 predicted 1650
9 SASI_Hs02_00344116 predicted 2918
10 SASI_Hs02_00344117 predicted 784
11 SASI_Hs01_00163146 predicted 762
12 SASI_Hs01_00163148 predicted 1036
13 SASI_Hs01_00163153 predicted 2430
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176787 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00369214 predicted 2345
2 SASI_Hs01_00166099 predicted 1989
3 SASI_Hs01_00166100 predicted 1170
4 SASI_Hs01_00166101 predicted 2390
5 SASI_Hs01_00166102 predicted 1432
6 SASI_Hs01_00166103 predicted 2603
7 SASI_Hs01_00166104 predicted 1117
8 SASI_Hs01_00166105 predicted 2728
9 SASI_Hs01_00166106 predicted 1728
10 SASI_Hs01_00166107 predicted 3000
11 SASI_Hs01_00166098 predicted 842
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055659 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00280521 predicted 1239
2 SASI_Rn02_00280522 predicted 1649
3 SASI_Rn02_00280523 predicted 1671
4 SASI_Rn02_00280524 predicted 380
5 SASI_Rn02_00280525 predicted 1310
6 SASI_Rn02_00280526 predicted 3020
7 SASI_Rn02_00280527 predicted 1997
8 SASI_Rn02_00280528 predicted 1802
9 SASI_Rn02_00280529 predicted 702
10 SASI_Rn02_00280530 predicted 3066
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_219411 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00195671 predicted 1384
2 SASI_Rn01_00195672 predicted 1574
3 SASI_Rn01_00195673 predicted 1734
4 SASI_Rn01_00195674 predicted 1548
5 SASI_Rn01_00195675 predicted 412
6 SASI_Rn01_00195676 predicted 1323
7 SASI_Rn01_00195677 predicted 2629
8 SASI_Rn01_00195678 predicted 2622
9 SASI_Rn01_00195679 predicted 1128
10 SASI_Rn01_00195680 predicted 1030
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013784 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00097420 predicted 2381
2 SASI_Mm01_00097421 predicted 1939
3 SASI_Mm01_00097422 predicted 3177
4 SASI_Mm01_00097423 predicted 1421
5 SASI_Mm01_00097424 predicted 1760
6 SASI_Mm01_00097425 predicted 3129
7 SASI_Mm01_00097426 predicted 1912
8 SASI_Mm01_00097427 predicted 1693
9 SASI_Mm01_00097429 predicted 2446
10 SASI_Mm02_00322739 predicted 756
11 SASI_Mm01_00097428 predicted 1854
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012327
PIGN MISSION shRNA Bacterial Glycerol Stock
phosphatidylinositol glycan anchor biosynthesis, class N
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012327.5-1763s21c1
Sequence:CCGGGTCTCATTCCAACCTTATAAACTCGAGTTTATAAGGTTGGAATGAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012327.3-1126s1c1
Sequence:CCGGCTGGTCATCCTTCAGAGACTTCTCGAGAAGTCTCTGAAGGATGACCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012327.3-2959s1c1
Sequence:CCGGGCTGGCTTGATATTGGGACAACTCGAGTTGTCCCAATATCAAGCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012327.3-1031s1c1
Sequence:CCGGCGTGTCTATGTTTAACCACTTCTCGAGAAGTGGTTAAACATAGACACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012327.3-1377s1c1
Sequence:CCGGGCAGAGAGCATGTTTACAAATCTCGAGATTTGTAAACATGCTCTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012327.5-571s21c1
Sequence:CCGGACTCTAGAGCACCGTTTATTACTCGAGTAATAAACGGTGCTCTAGAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420910    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012327.5-3580s21c1
Sequence:CCGGACCAGGTGCCACCGTCAATATCTCGAGATATTGACGGTGGCACCTGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012327.5-537s21c1
Sequence:CCGGGCAGATGCACTTTACGAATTACTCGAGTAATTCGTAAAGTGCATCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145406    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012327.3-4336s1c1
Sequence:CCGGGTCAGAAATCAGTTTGGCAAACTCGAGTTTGCCAAACTGATTTCTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012327.3-2150s1c1
Sequence:CCGGGCCAGACATCTCTCTAGTGATCTCGAGATCACTAGAGAGATGTCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012327
PIGN MISSION shRNA shRNA Plasmid DNA
phosphatidylinositol glycan anchor biosynthesis, class N
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012327.5-1763s21c1
Sequence:CCGGGTCTCATTCCAACCTTATAAACTCGAGTTTATAAGGTTGGAATGAGACTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000141512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012327.3-1126s1c1
Sequence:CCGGCTGGTCATCCTTCAGAGACTTCTCGAGAAGTCTCTGAAGGATGACCAGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000142457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012327.3-2959s1c1
Sequence:CCGGGCTGGCTTGATATTGGGACAACTCGAGTTGTCCCAATATCAAGCCAGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000144229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012327.3-1031s1c1
Sequence:CCGGCGTGTCTATGTTTAACCACTTCTCGAGAAGTGGTTAAACATAGACACGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000145328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012327.3-1377s1c1
Sequence:CCGGGCAGAGAGCATGTTTACAAATCTCGAGATTTGTAAACATGCTCTCTGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000412394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012327.5-571s21c1
Sequence:CCGGACTCTAGAGCACCGTTTATTACTCGAGTAATAAACGGTGCTCTAGAGTTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000420910    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012327.5-3580s21c1
Sequence:CCGGACCAGGTGCCACCGTCAATATCTCGAGATATTGACGGTGGCACCTGGTTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000433357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012327.5-537s21c1
Sequence:CCGGGCAGATGCACTTTACGAATTACTCGAGTAATTCGTAAAGTGCATCTGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000145406    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012327.3-4336s1c1
Sequence:CCGGGTCAGAAATCAGTTTGGCAAACTCGAGTTTGCCAAACTGATTTCTGACTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000142421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012327.3-2150s1c1
Sequence:CCGGGCCAGACATCTCTCTAGTGATCTCGAGATCACTAGAGAGATGTCTGGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012327
PIGN MISSION shRNA Lentiviral Transduction Particles
phosphatidylinositol glycan anchor biosynthesis, class N
Human
10 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000433569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012327.5-1763s21c1
Sequence:CCGGGTCTCATTCCAACCTTATAAACTCGAGTTTATAAGGTTGGAATGAGACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012327.3-1126s1c1
Sequence:CCGGCTGGTCATCCTTCAGAGACTTCTCGAGAAGTCTCTGAAGGATGACCAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012327.3-2959s1c1
Sequence:CCGGGCTGGCTTGATATTGGGACAACTCGAGTTGTCCCAATATCAAGCCAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012327.3-1031s1c1
Sequence:CCGGCGTGTCTATGTTTAACCACTTCTCGAGAAGTGGTTAAACATAGACACGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012327.3-1377s1c1
Sequence:CCGGGCAGAGAGCATGTTTACAAATCTCGAGATTTGTAAACATGCTCTCTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012327.5-571s21c1
Sequence:CCGGACTCTAGAGCACCGTTTATTACTCGAGTAATAAACGGTGCTCTAGAGTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420910    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012327.5-3580s21c1
Sequence:CCGGACCAGGTGCCACCGTCAATATCTCGAGATATTGACGGTGGCACCTGGTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012327.5-537s21c1
Sequence:CCGGGCAGATGCACTTTACGAATTACTCGAGTAATTCGTAAAGTGCATCTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145406    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012327.3-4336s1c1
Sequence:CCGGGTCAGAAATCAGTTTGGCAAACTCGAGTTTGCCAAACTGATTTCTGACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012327.3-2150s1c1
Sequence:CCGGGCCAGACATCTCTCTAGTGATCTCGAGATCACTAGAGAGATGTCTGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013784
VALIDATED
PIGN MISSION shRNA Bacterial Glycerol Stock
phosphatidylinositol glycan anchor biosynthesis, class N
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000126399    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013784.1-3207s1c1
Sequence:CCGGGCATCCTGATTCTCCTTCTTACTCGAGTAAGAAGGAGAATCAGGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013784.1-1394s1c1
Sequence:CCGGCCTCTTAATTCGGTGGGAATACTCGAGTATTCCCACCGAATTAAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013784.1-2029s1c1
Sequence:CCGGGCTTGTCTTTACCTTGGGTATCTCGAGATACCCAAGGTAAAGACAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013784.1-2227s1c1
Sequence:CCGGGCCAAACCTTTCTCTAGTAATCTCGAGATTACTAGAGAAAGGTTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013784.1-743s1c1
Sequence:CCGGCCTGTAGAATTTGACTCTCTTCTCGAGAAGAGAGTCAAATTCTACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013784
VALIDATED
PIGN MISSION shRNA shRNA Plasmid DNA
phosphatidylinositol glycan anchor biosynthesis, class N
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000126399    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013784.1-3207s1c1
Sequence:CCGGGCATCCTGATTCTCCTTCTTACTCGAGTAAGAAGGAGAATCAGGATGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000126402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013784.1-1394s1c1
Sequence:CCGGCCTCTTAATTCGGTGGGAATACTCGAGTATTCCCACCGAATTAAGAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000126403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013784.1-2029s1c1
Sequence:CCGGGCTTGTCTTTACCTTGGGTATCTCGAGATACCCAAGGTAAAGACAAGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000126400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013784.1-2227s1c1
Sequence:CCGGGCCAAACCTTTCTCTAGTAATCTCGAGATTACTAGAGAAAGGTTTGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000126401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013784.1-743s1c1
Sequence:CCGGCCTGTAGAATTTGACTCTCTTCTCGAGAAGAGAGTCAAATTCTACAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013784
VALIDATED
PIGN MISSION shRNA Lentiviral Transduction Particles
phosphatidylinositol glycan anchor biosynthesis, class N
Mouse
5 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000126399    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013784.1-3207s1c1
Sequence:CCGGGCATCCTGATTCTCCTTCTTACTCGAGTAAGAAGGAGAATCAGGATGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013784.1-1394s1c1
Sequence:CCGGCCTCTTAATTCGGTGGGAATACTCGAGTATTCCCACCGAATTAAGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013784.1-2029s1c1
Sequence:CCGGGCTTGTCTTTACCTTGGGTATCTCGAGATACCCAAGGTAAAGACAAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013784.1-2227s1c1
Sequence:CCGGGCCAAACCTTTCTCTAGTAATCTCGAGATTACTAGAGAAAGGTTTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013784.1-743s1c1
Sequence:CCGGCCTGTAGAATTTGACTCTCTTCTCGAGAAGAGAGTCAAATTCTACAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)