EMAIL THIS PAGE TO A FRIEND

PIGQ

phosphatidylinositol glycan anchor biosynthesis, class Q

69 Gene Product Result for
Synonyms: GPI1 c407A10.1
Gene ID:
Human(9091) Summary: This gene is involved in the first step in glycosylphosphatidylinositol (GPI)-anchor biosynthesis. The GPI-anchor is a glycolipid found on many blood cells and serves to anchor proteins to the cell surface. This gene encodes a N-acetylglucosaminyl transferase component that is part of the complex that catalyzes transfer of N-acetylglucosamine (GlcNAc) from UDP-GlcNAc to phosphatidylinositol (PI). Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2012]
Mouse(14755) phosphatidylinositol glycan anchor biosynthesis, class Q
Rat(287159) phosphatidylinositol glycan anchor biosynthesis, class Q
Zebrafish(321218) phosphatidylinositol glycan, class Q
Horse(100065181) phosphatidylinositol glycan anchor biosynthesis, class Q
domestic cat(101088291) phosphatidylinositol glycan anchor biosynthesis, class Q
dog(490095) phosphatidylinositol glycan anchor biosynthesis, class Q
chicken(770171) phosphatidylinositol glycan anchor biosynthesis, class Q
cow(508048) phosphatidylinositol glycan anchor biosynthesis, class Q
sheep(101102364) phosphatidylinositol glycan anchor biosynthesis, class Q
domestic guinea pig(100714528) phosphatidylinositol glycan anchor biosynthesis, class Q
naked mole-rat(101725434) phosphatidylinositol glycan anchor biosynthesis, class Q
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011822 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011822 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011822 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004204 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004204 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004204 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004204 Rosetta Predictions human pricing
NM_148920 Rosetta Predictions human pricing
NM_001007607 Rosetta Predictions rat pricing
NM_011822 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004204 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00091145 predicted 466
2 SASI_Hs02_00337101 predicted 730
3 SASI_Hs01_00091148 predicted 766
4 SASI_Hs01_00091149 predicted 863
5 SASI_Hs02_00337102 predicted 628
6 SASI_Hs01_00091150 predicted 1990
7 SASI_Hs01_00091151 predicted 2002
8 SASI_Hs02_00337103 predicted 1913
9 SASI_Hs01_00091152 predicted 1191
10 SASI_Hs01_00091153 predicted 820
11 SASI_Hs01_00091146 predicted 1331
12 SASI_Hs01_00091147 predicted 1925
13 SASI_Hs01_00091154 predicted 879
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_148920 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00086930 predicted 472
2 SASI_Hs01_00086933 predicted 766
3 SASI_Hs01_00086934 predicted 861
4 SASI_Hs02_00365650 predicted 630
5 SASI_Hs01_00086935 predicted 1941
6 SASI_Hs02_00365651 predicted 1851
7 SASI_Hs01_00086936 predicted 1193
8 SASI_Hs01_00086937 predicted 827
9 SASI_Hs01_00086938 predicted 873
10 SASI_Hs01_00086939 predicted 2621
11 SASI_Hs01_00086931 predicted 1332
12 SASI_Hs01_00086932 predicted 1863
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007607 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00114649 predicted 936
2 SASI_Rn01_00114650 predicted 1433
3 SASI_Rn02_00198692 predicted 1212
4 SASI_Rn01_00114651 predicted 1648
5 SASI_Rn01_00114652 predicted 370
6 SASI_Rn01_00114653 predicted 1821
7 SASI_Rn01_00114654 predicted 304
8 SASI_Rn01_00114655 predicted 1488
9 SASI_Rn01_00114656 predicted 474
10 SASI_Rn01_00114657 predicted 1502
11 SASI_Rn01_00114658 predicted 1496
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011822 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00140798 predicted 860
2 SASI_Mm01_00140799 predicted 480
3 SASI_Mm01_00140801 predicted 1761
4 SASI_Mm01_00140802 predicted 977
5 SASI_Mm01_00140803 predicted 1923
6 SASI_Mm01_00140804 predicted 1054
7 SASI_Mm02_00321529 predicted 754
8 SASI_Mm01_00140805 predicted 1596
9 SASI_Mm01_00140806 predicted 1973
10 SASI_Mm01_00140807 predicted 1586
11 SASI_Mm01_00140800 predicted 1553
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011822
PIGQ MISSION shRNA Bacterial Glycerol Stock
phosphatidylinositol glycan anchor biosynthesis, class Q
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000345691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011822.3-1223s21c1
Sequence:CCGGGATAAGCTATATCCACCTTATCTCGAGATAAGGTGGATATAGCTTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011822.2-1760s1c1
Sequence:CCGGCCTGTCCTATAACCATGTGATCTCGAGATCACATGGTTATAGGACAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011822.2-1461s1c1
Sequence:CCGGCGAGTGGATTCTTGTTCCTATCTCGAGATAGGAACAAGAATCCACTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011822.2-681s1c1
Sequence:CCGGCTCTTCCGAAATGACCAATTTCTCGAGAAATTGGTCATTTCGGAAGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011822.2-1547s1c1
Sequence:CCGGCGCTCTGTACTACCTGGTATTCTCGAGAATACCAGGTAGTACAGAGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011822.2-1223s1c1
Sequence:CCGGGATAAGCTATATCCACCTTATCTCGAGATAAGGTGGATATAGCTTATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011822.3-681s21c1
Sequence:CCGGCTCTTCCGAAATGACCAATTTCTCGAGAAATTGGTCATTTCGGAAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011822.3-1547s21c1
Sequence:CCGGCGCTCTGTACTACCTGGTATTCTCGAGAATACCAGGTAGTACAGAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011822.3-1760s21c1
Sequence:CCGGCCTGTCCTATAACCATGTGATCTCGAGATCACATGGTTATAGGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011822
PIGQ MISSION shRNA shRNA Plasmid DNA
phosphatidylinositol glycan anchor biosynthesis, class Q
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000345691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011822.3-1223s21c1
Sequence:CCGGGATAAGCTATATCCACCTTATCTCGAGATAAGGTGGATATAGCTTATCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000018426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011822.2-1760s1c1
Sequence:CCGGCCTGTCCTATAACCATGTGATCTCGAGATCACATGGTTATAGGACAGGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000018427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011822.2-1461s1c1
Sequence:CCGGCGAGTGGATTCTTGTTCCTATCTCGAGATAGGAACAAGAATCCACTCGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000018428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011822.2-681s1c1
Sequence:CCGGCTCTTCCGAAATGACCAATTTCTCGAGAAATTGGTCATTTCGGAAGAGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000018429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011822.2-1547s1c1
Sequence:CCGGCGCTCTGTACTACCTGGTATTCTCGAGAATACCAGGTAGTACAGAGCGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000018430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011822.2-1223s1c1
Sequence:CCGGGATAAGCTATATCCACCTTATCTCGAGATAAGGTGGATATAGCTTATCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000345765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011822.3-681s21c1
Sequence:CCGGCTCTTCCGAAATGACCAATTTCTCGAGAAATTGGTCATTTCGGAAGAGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000345692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011822.3-1547s21c1
Sequence:CCGGCGCTCTGTACTACCTGGTATTCTCGAGAATACCAGGTAGTACAGAGCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000345693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011822.3-1760s21c1
Sequence:CCGGCCTGTCCTATAACCATGTGATCTCGAGATCACATGGTTATAGGACAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011822
PIGQ MISSION shRNA Lentiviral Transduction Particles
phosphatidylinositol glycan anchor biosynthesis, class Q
Mouse
9 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000345691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011822.3-1223s21c1
Sequence:CCGGGATAAGCTATATCCACCTTATCTCGAGATAAGGTGGATATAGCTTATCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011822.2-1760s1c1
Sequence:CCGGCCTGTCCTATAACCATGTGATCTCGAGATCACATGGTTATAGGACAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011822.2-1461s1c1
Sequence:CCGGCGAGTGGATTCTTGTTCCTATCTCGAGATAGGAACAAGAATCCACTCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011822.2-681s1c1
Sequence:CCGGCTCTTCCGAAATGACCAATTTCTCGAGAAATTGGTCATTTCGGAAGAGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011822.2-1547s1c1
Sequence:CCGGCGCTCTGTACTACCTGGTATTCTCGAGAATACCAGGTAGTACAGAGCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011822.2-1223s1c1
Sequence:CCGGGATAAGCTATATCCACCTTATCTCGAGATAAGGTGGATATAGCTTATCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011822.3-681s21c1
Sequence:CCGGCTCTTCCGAAATGACCAATTTCTCGAGAAATTGGTCATTTCGGAAGAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011822.3-1547s21c1
Sequence:CCGGCGCTCTGTACTACCTGGTATTCTCGAGAATACCAGGTAGTACAGAGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011822.3-1760s21c1
Sequence:CCGGCCTGTCCTATAACCATGTGATCTCGAGATCACATGGTTATAGGACAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004204
VALIDATED
PIGQ MISSION shRNA Bacterial Glycerol Stock
phosphatidylinositol glycan anchor biosynthesis, class Q
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000178916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004204.2-475s1c1
Sequence:CCGGCAGGTCATGCTCATCTTCTATCTCGAGATAGAAGATGAGCATGACCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004204.2-876s1c1
Sequence:CCGGGCTAATCTTCAGTACACGGAACTCGAGTTCCGTGTACTGAAGATTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180474    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004204.2-2578s1c1
Sequence:CCGGGCCAAATCTGTCTCCCTTCATCTCGAGATGAAGGGAGACAGATTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243328    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004204.2-2524s21c1
Sequence:CCGGACTGACCCAGCCGTACCTATTCTCGAGAATAGGTACGGCTGGGTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004204.2-1679s21c1
Sequence:CCGGTCCGCCTCCTGATGCAGATAACTCGAGTTATCTGCATCAGGAGGCGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004204.2-476s21c1
Sequence:CCGGAGGTCATGCTCATCTTCTATGCTCGAGCATAGAAGATGAGCATGACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004204.2-628s21c1
Sequence:CCGGTTCCGCAGTGACCGCTTTGATCTCGAGATCAAAGCGGTCACTGCGGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004204.2-1257s21c1
Sequence:CCGGGTCCCTCCTCTCGGACATTATCTCGAGATAATGTCCGAGAGGAGGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004204
VALIDATED
PIGQ MISSION shRNA shRNA Plasmid DNA
phosphatidylinositol glycan anchor biosynthesis, class Q
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000178916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004204.2-475s1c1
Sequence:CCGGCAGGTCATGCTCATCTTCTATCTCGAGATAGAAGATGAGCATGACCTGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000179525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004204.2-876s1c1
Sequence:CCGGGCTAATCTTCAGTACACGGAACTCGAGTTCCGTGTACTGAAGATTAGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000180474    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004204.2-2578s1c1
Sequence:CCGGGCCAAATCTGTCTCCCTTCATCTCGAGATGAAGGGAGACAGATTTGGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000243328    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004204.2-2524s21c1
Sequence:CCGGACTGACCCAGCCGTACCTATTCTCGAGAATAGGTACGGCTGGGTCAGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000243327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004204.2-1679s21c1
Sequence:CCGGTCCGCCTCCTGATGCAGATAACTCGAGTTATCTGCATCAGGAGGCGGATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000243326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004204.2-476s21c1
Sequence:CCGGAGGTCATGCTCATCTTCTATGCTCGAGCATAGAAGATGAGCATGACCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000243325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004204.2-628s21c1
Sequence:CCGGTTCCGCAGTGACCGCTTTGATCTCGAGATCAAAGCGGTCACTGCGGAATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000243324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004204.2-1257s21c1
Sequence:CCGGGTCCCTCCTCTCGGACATTATCTCGAGATAATGTCCGAGAGGAGGGACTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004204
VALIDATED
PIGQ MISSION shRNA Lentiviral Transduction Particles
phosphatidylinositol glycan anchor biosynthesis, class Q
Human
8 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000178916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004204.2-475s1c1
Sequence:CCGGCAGGTCATGCTCATCTTCTATCTCGAGATAGAAGATGAGCATGACCTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004204.2-876s1c1
Sequence:CCGGGCTAATCTTCAGTACACGGAACTCGAGTTCCGTGTACTGAAGATTAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180474    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004204.2-2578s1c1
Sequence:CCGGGCCAAATCTGTCTCCCTTCATCTCGAGATGAAGGGAGACAGATTTGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243328    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004204.2-2524s21c1
Sequence:CCGGACTGACCCAGCCGTACCTATTCTCGAGAATAGGTACGGCTGGGTCAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004204.2-1679s21c1
Sequence:CCGGTCCGCCTCCTGATGCAGATAACTCGAGTTATCTGCATCAGGAGGCGGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004204.2-476s21c1
Sequence:CCGGAGGTCATGCTCATCTTCTATGCTCGAGCATAGAAGATGAGCATGACCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004204.2-628s21c1
Sequence:CCGGTTCCGCAGTGACCGCTTTGATCTCGAGATCAAAGCGGTCACTGCGGAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004204.2-1257s21c1
Sequence:CCGGGTCCCTCCTCTCGGACATTATCTCGAGATAATGTCCGAGAGGAGGGACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)