EMAIL THIS PAGE TO A FRIEND

PIGS

phosphatidylinositol glycan anchor biosynthesis, class S

43 Gene Product Result for
UniProtKB ID: Q96S52, Q6UVX6
Gene ID:
Human(94005) Summary: This gene encodes a protein that is involved in GPI-anchor biosynthesis. The glycosylphosphatidylinositol (GPI) anchor is a glycolipid found on many blood cells and serves to anchor proteins to the cell surface. This gene encodes an essential component of the multisubunit enzyme, GPI transamidase. GPI transamidase mediates GPI anchoring in the endoplasmic reticulum, by catalyzing the transfer of fully assembled GPI units to proteins. [provided by RefSeq, Jul 2008]
Mouse(276846) phosphatidylinositol glycan anchor biosynthesis, class S
Rat(303277) phosphatidylinositol glycan anchor biosynthesis, class S
fruit fly(31596) pickled eggs
Zebrafish(767675) phosphatidylinositol glycan anchor biosynthesis, class S
chicken(417571) phosphatidylinositol glycan anchor biosynthesis, class S
dog(491170) phosphatidylinositol glycan anchor biosynthesis, class S
Horse(100059193) phosphatidylinositol glycan anchor biosynthesis, class S
domestic cat(101098905) phosphatidylinositol glycan anchor biosynthesis, class S
cow(504583) phosphatidylinositol glycan anchor biosynthesis, class S
sheep(101120255) phosphatidylinositol glycan anchor biosynthesis, class S
domestic guinea pig(100726114) phosphatidylinositol glycan anchor biosynthesis, class S
Domestic Rabbit(100348342) phosphatidylinositol glycan anchor biosynthesis, class S
naked mole-rat(101709905) phosphatidylinositol glycan anchor biosynthesis, class S
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033198 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033198 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033198 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_201406 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_201406 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_201406 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033198 Rosetta Predictions human pricing
NM_001006602 Rosetta Predictions rat pricing
NM_201406 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033198 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00107540 predicted 1729
2 SASI_Hs01_00107541 predicted 888
3 SASI_Hs01_00107543 predicted 822
4 SASI_Hs01_00107544 predicted 1365
5 SASI_Hs01_00107545 predicted 433
6 SASI_Hs01_00107546 predicted 1178
7 SASI_Hs01_00107547 predicted 689
8 SASI_Hs02_00360989 predicted 1235
9 SASI_Hs01_00107549 predicted 1566
10 SASI_Hs02_00360990 predicted 1260
11 SASI_Hs01_00107542 predicted 967
12 SASI_Hs01_00107548 predicted 809
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006602 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00092615 predicted 429
2 SASI_Rn01_00092616 predicted 1083
3 SASI_Rn01_00092617 predicted 537
4 SASI_Rn01_00092619 predicted 194
5 SASI_Rn01_00092620 predicted 680
6 SASI_Rn01_00092621 predicted 634
7 SASI_Rn02_00198500 predicted 198
8 SASI_Rn01_00092622 predicted 384
9 SASI_Rn01_00092623 predicted 301
10 SASI_Rn02_00198501 predicted 761
11 SASI_Rn01_00092618 predicted 272
12 SASI_Rn01_00092624 predicted 241
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201406 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00165724 predicted 474
2 SASI_Mm01_00165725 predicted 435
3 SASI_Mm01_00165726 predicted 313
4 SASI_Mm01_00165727 predicted 727
5 SASI_Mm01_00165728 predicted 1596
6 SASI_Mm01_00165729 predicted 292
7 SASI_Mm01_00165730 predicted 1660
8 SASI_Mm01_00165731 predicted 583
9 SASI_Mm02_00351579 predicted 848
10 SASI_Mm01_00165733 predicted 1008
11 SASI_Mm01_00165732 predicted 247
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033198
VALIDATED
PIGS MISSION shRNA Bacterial Glycerol Stock
phosphatidylinositol glycan anchor biosynthesis, class S
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000131220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_033198.2-588s1c1
Sequence:CCGGGCCATGTCTTTGACTGAGGATCTCGAGATCCTCAGTCAAAGACATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_033198.2-691s1c1
Sequence:CCGGGCTATGAGATCACCTTCAGTTCTCGAGAACTGAAGGTGATCTCATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_033198.2-884s1c1
Sequence:CCGGCTCCAGCTACTATTTGGACATCTCGAGATGTCCAAATAGTAGCTGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_033198.2-1562s1c1
Sequence:CCGGCCAGAAGTTTGCCATCTACATCTCGAGATGTAGATGGCAAACTTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_033198.2-698s1c1
Sequence:CCGGGATCACCTTCAGTTTACTCAACTCGAGTTGAGTAAACTGAAGGTGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033198.3-1057s21c1
Sequence:CCGGGATCACCTTCAGTTTACTCAACTCGAGTTGAGTAAACTGAAGGTGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033198.3-947s21c1
Sequence:CCGGGCCATGTCTTTGACTGAGGATCTCGAGATCCTCAGTCAAAGACATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033198.3-1243s21c1
Sequence:CCGGCTCCAGCTACTATTTGGACATCTCGAGATGTCCAAATAGTAGCTGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033198.3-1921s21c1
Sequence:CCGGCCAGAAGTTTGCCATCTACATCTCGAGATGTAGATGGCAAACTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033198
VALIDATED
PIGS MISSION shRNA shRNA Plasmid DNA
phosphatidylinositol glycan anchor biosynthesis, class S
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000131220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_033198.2-588s1c1
Sequence:CCGGGCCATGTCTTTGACTGAGGATCTCGAGATCCTCAGTCAAAGACATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_033198.2-691s1c1
Sequence:CCGGGCTATGAGATCACCTTCAGTTCTCGAGAACTGAAGGTGATCTCATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_033198.2-884s1c1
Sequence:CCGGCTCCAGCTACTATTTGGACATCTCGAGATGTCCAAATAGTAGCTGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_033198.2-1562s1c1
Sequence:CCGGCCAGAAGTTTGCCATCTACATCTCGAGATGTAGATGGCAAACTTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_033198.2-698s1c1
Sequence:CCGGGATCACCTTCAGTTTACTCAACTCGAGTTGAGTAAACTGAAGGTGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033198.3-1057s21c1
Sequence:CCGGGATCACCTTCAGTTTACTCAACTCGAGTTGAGTAAACTGAAGGTGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033198.3-947s21c1
Sequence:CCGGGCCATGTCTTTGACTGAGGATCTCGAGATCCTCAGTCAAAGACATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033198.3-1243s21c1
Sequence:CCGGCTCCAGCTACTATTTGGACATCTCGAGATGTCCAAATAGTAGCTGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033198.3-1921s21c1
Sequence:CCGGCCAGAAGTTTGCCATCTACATCTCGAGATGTAGATGGCAAACTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033198
VALIDATED
PIGS MISSION shRNA Lentiviral Transduction Particles
phosphatidylinositol glycan anchor biosynthesis, class S
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000131220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_033198.2-588s1c1
Sequence:CCGGGCCATGTCTTTGACTGAGGATCTCGAGATCCTCAGTCAAAGACATGGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000130424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_033198.2-691s1c1
Sequence:CCGGGCTATGAGATCACCTTCAGTTCTCGAGAACTGAAGGTGATCTCATAGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000130246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_033198.2-884s1c1
Sequence:CCGGCTCCAGCTACTATTTGGACATCTCGAGATGTCCAAATAGTAGCTGGAGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000130093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_033198.2-1562s1c1
Sequence:CCGGCCAGAAGTTTGCCATCTACATCTCGAGATGTAGATGGCAAACTTCTGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000129960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_033198.2-698s1c1
Sequence:CCGGGATCACCTTCAGTTTACTCAACTCGAGTTGAGTAAACTGAAGGTGATCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000297958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033198.3-1057s21c1
Sequence:CCGGGATCACCTTCAGTTTACTCAACTCGAGTTGAGTAAACTGAAGGTGATCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000292164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033198.3-947s21c1
Sequence:CCGGGCCATGTCTTTGACTGAGGATCTCGAGATCCTCAGTCAAAGACATGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000292163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033198.3-1243s21c1
Sequence:CCGGCTCCAGCTACTATTTGGACATCTCGAGATGTCCAAATAGTAGCTGGAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000292165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033198.3-1921s21c1
Sequence:CCGGCCAGAAGTTTGCCATCTACATCTCGAGATGTAGATGGCAAACTTCTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_201406
PIGS MISSION shRNA Bacterial Glycerol Stock
phosphatidylinositol glycan anchor biosynthesis, class S
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000193371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201406.1-1601s1c1
Sequence:CCGGCCAGAAGTTTGCTATCTACATCTCGAGATGTAGATAGCAAACTTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201406.1-836s21c1
Sequence:CCGGCCTCAGTGTTGCGGGCAATTTCTCGAGAAATTGCCCGCAACACTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201406.1-861s21c1
Sequence:CCGGGTGGACTCTCAGATCCTATACCTCGAGGTATAGGATCTGAGAGTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201406.1-1657s21c1
Sequence:CCGGTGTCCCTGGTTAAGATCTTTCCTCGAGGAAAGATCTTAACCAGGGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201406.1-1141s21c1
Sequence:CCGGATGTTGATCCGAAGATCTATACTCGAGTATAGATCTTCGGATCAACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249537    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_201406.1-2024s21c1
Sequence:CCGGACGCACTGAGAGGTGAATTTACTCGAGTAAATTCACCTCTCAGTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175866    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_201406.1-2277s1c1
Sequence:CCGGGCTTCTGCACTTAACAGACTACTCGAGTAGTCTGTTAAGTGCAGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_201406
PIGS MISSION shRNA shRNA Plasmid DNA
phosphatidylinositol glycan anchor biosynthesis, class S
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000193371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201406.1-1601s1c1
Sequence:CCGGCCAGAAGTTTGCTATCTACATCTCGAGATGTAGATAGCAAACTTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201406.1-836s21c1
Sequence:CCGGCCTCAGTGTTGCGGGCAATTTCTCGAGAAATTGCCCGCAACACTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201406.1-861s21c1
Sequence:CCGGGTGGACTCTCAGATCCTATACCTCGAGGTATAGGATCTGAGAGTCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201406.1-1657s21c1
Sequence:CCGGTGTCCCTGGTTAAGATCTTTCCTCGAGGAAAGATCTTAACCAGGGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201406.1-1141s21c1
Sequence:CCGGATGTTGATCCGAAGATCTATACTCGAGTATAGATCTTCGGATCAACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249537    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_201406.1-2024s21c1
Sequence:CCGGACGCACTGAGAGGTGAATTTACTCGAGTAAATTCACCTCTCAGTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175866    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_201406.1-2277s1c1
Sequence:CCGGGCTTCTGCACTTAACAGACTACTCGAGTAGTCTGTTAAGTGCAGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_201406
PIGS MISSION shRNA Lentiviral Transduction Particles
phosphatidylinositol glycan anchor biosynthesis, class S
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000193371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201406.1-1601s1c1
Sequence:CCGGCCAGAAGTTTGCTATCTACATCTCGAGATGTAGATAGCAAACTTCTGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000249538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201406.1-836s21c1
Sequence:CCGGCCTCAGTGTTGCGGGCAATTTCTCGAGAAATTGCCCGCAACACTGAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000257938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201406.1-861s21c1
Sequence:CCGGGTGGACTCTCAGATCCTATACCTCGAGGTATAGGATCTGAGAGTCCACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000249539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201406.1-1657s21c1
Sequence:CCGGTGTCCCTGGTTAAGATCTTTCCTCGAGGAAAGATCTTAACCAGGGACATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000249536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201406.1-1141s21c1
Sequence:CCGGATGTTGATCCGAAGATCTATACTCGAGTATAGATCTTCGGATCAACATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000249537    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_201406.1-2024s21c1
Sequence:CCGGACGCACTGAGAGGTGAATTTACTCGAGTAAATTCACCTCTCAGTGCGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000175866    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_201406.1-2277s1c1
Sequence:CCGGGCTTCTGCACTTAACAGACTACTCGAGTAGTCTGTTAAGTGCAGAAGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???