EMAIL THIS PAGE TO A FRIEND

PIGU

phosphatidylinositol glycan anchor biosynthesis, class U

155 Gene Product Result for
Synonyms: CDC91L1 GAB1
UniProtKB ID: Q9H490, Q7Z489, Q8N2F2
Gene ID:
Human(128869) Summary: The protein encoded by this gene shares similarity with Saccharomyces cerevisiae Cdc91, a predicted integral membrane protein that may function in cell division control. The protein encoded by this gene is the fifth subunit of GPI transamidase that attaches GPI-anchors to proteins. [provided by RefSeq, Jul 2008]
Mouse(228812) phosphatidylinositol glycan anchor biosynthesis, class U
Rat(353304) phosphatidylinositol glycan anchor biosynthesis, class U
Zebrafish(560242) phosphatidylinositol glycan anchor biosynthesis, class U
chicken(419124) phosphatidylinositol glycan anchor biosynthesis, class U
Horse(100054427) phosphatidylinositol glycan anchor biosynthesis, class U
domestic cat(101085198) phosphatidylinositol glycan anchor biosynthesis, class U
dog(485846) phosphatidylinositol glycan anchor biosynthesis, class U
cow(535138) phosphatidylinositol glycan anchor biosynthesis, class U
sheep(101118548) phosphatidylinositol glycan anchor biosynthesis, class U
domestic guinea pig(100728414) phosphatidylinositol glycan anchor biosynthesis, class U
naked mole-rat(101709494) phosphatidylinositol glycan anchor biosynthesis, class U
Domestic Rabbit(100346698) phosphatidylinositol glycan anchor biosynthesis, class U
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080476 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080476 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080476 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001004721 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001004721 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001004721 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU069371 MISSION® esiRNA targeting human PIGU human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080476 Rosetta Predictions human pricing
NM_181637 Rosetta Predictions rat pricing
NM_001004721 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080476 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00137501 predicted 411
2 SASI_Hs01_00137502 predicted 931
3 SASI_Hs01_00137503 predicted 471
4 SASI_Hs01_00137504 predicted 769
5 SASI_Hs02_00362277 predicted 1055
6 SASI_Hs01_00137505 predicted 626
7 SASI_Hs01_00137506 predicted 1401
8 SASI_Hs01_00137507 predicted 429
9 SASI_Hs01_00137508 predicted 1232
10 SASI_Hs01_00137509 predicted 487
11 SASI_Hs01_00137510 predicted 1242
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181637 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00097319 predicted 375
2 SASI_Rn01_00097320 predicted 891
3 SASI_Rn01_00097321 predicted 237
4 SASI_Rn02_00269779 predicted 634
5 SASI_Rn01_00097322 predicted 266
6 SASI_Rn01_00097323 predicted 765
7 SASI_Rn01_00097324 predicted 232
8 SASI_Rn01_00097325 predicted 358
9 SASI_Rn01_00097326 predicted 1236
10 SASI_Rn01_00097327 predicted 1202
11 SASI_Rn01_00097318 predicted 213
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004721 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00104419 predicted 317
2 SASI_Mm01_00104420 predicted 743
3 SASI_Mm01_00104421 predicted 264
4 SASI_Mm01_00104422 predicted 928
5 SASI_Mm01_00104424 predicted 218
6 SASI_Mm01_00104425 predicted 790
7 SASI_Mm01_00104426 predicted 922
8 SASI_Mm01_00104427 predicted 930
9 SASI_Mm02_00286550 predicted 265
10 SASI_Mm01_00104428 predicted 438
11 SASI_Mm01_00104423 predicted 298
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080476
VALIDATED
PIGU MISSION shRNA Bacterial Glycerol Stock
phosphatidylinositol glycan anchor biosynthesis, class U
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000129318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_080476.3-1076s1c1
Sequence:CCGGCCTGCATCATCATCGTCTGTTCTCGAGAACAGACGATGATGATGCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080476.3-1053s1c1
Sequence:CCGGCCTGAGAAACATCTTTGTCCTCTCGAGAGGACAAAGATGTTTCTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_080476.3-948s1c1
Sequence:CCGGGTTTATCCAGATCGCTGTCATCTCGAGATGACAGCGATCTGGATAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080476.3-292s1c1
Sequence:CCGGGCAATCCAGGACTTCAATAAACTCGAGTTTATTGAAGTCCTGGATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080476.3-876s1c1
Sequence:CCGGGTTTCAGATCAACGTCTTCTTCTCGAGAAGAAGACGTTGATCTGAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080476.4-433s21c1
Sequence:CCGGACTATGCTGAATTGGTGTTTACTCGAGTAAACACCAATTCAGCATAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080476.4-459s21c1
Sequence:CCGGACTGATGCACTCACTGCTATTCTCGAGAATAGCAGTGAGTGCATCAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080476.4-904s21c1
Sequence:CCGGGAAGCCTAGTGGTAATCATTTCTCGAGAAATGATTACCACTAGGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080476.4-369s21c1
Sequence:CCGGCCGTATTCTGGAGCAGTATTTCTCGAGAAATACTGCTCCAGAATACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080476
VALIDATED
PIGU MISSION shRNA shRNA Plasmid DNA
phosphatidylinositol glycan anchor biosynthesis, class U
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000129318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_080476.3-1076s1c1
Sequence:CCGGCCTGCATCATCATCGTCTGTTCTCGAGAACAGACGATGATGATGCAGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000129213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080476.3-1053s1c1
Sequence:CCGGCCTGAGAAACATCTTTGTCCTCTCGAGAGGACAAAGATGTTTCTCAGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000129146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_080476.3-948s1c1
Sequence:CCGGGTTTATCCAGATCGCTGTCATCTCGAGATGACAGCGATCTGGATAAACTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000128579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080476.3-292s1c1
Sequence:CCGGGCAATCCAGGACTTCAATAAACTCGAGTTTATTGAAGTCCTGGATTGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000128366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080476.3-876s1c1
Sequence:CCGGGTTTCAGATCAACGTCTTCTTCTCGAGAAGAAGACGTTGATCTGAAACTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000428147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080476.4-433s21c1
Sequence:CCGGACTATGCTGAATTGGTGTTTACTCGAGTAAACACCAATTCAGCATAGTTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000416343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080476.4-459s21c1
Sequence:CCGGACTGATGCACTCACTGCTATTCTCGAGAATAGCAGTGAGTGCATCAGTTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000413660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080476.4-904s21c1
Sequence:CCGGGAAGCCTAGTGGTAATCATTTCTCGAGAAATGATTACCACTAGGCTTCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000421459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080476.4-369s21c1
Sequence:CCGGCCGTATTCTGGAGCAGTATTTCTCGAGAAATACTGCTCCAGAATACGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080476
VALIDATED
PIGU MISSION shRNA Lentiviral Transduction Particles
phosphatidylinositol glycan anchor biosynthesis, class U
Human
9 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000129318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_080476.3-1076s1c1
Sequence:CCGGCCTGCATCATCATCGTCTGTTCTCGAGAACAGACGATGATGATGCAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080476.3-1053s1c1
Sequence:CCGGCCTGAGAAACATCTTTGTCCTCTCGAGAGGACAAAGATGTTTCTCAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_080476.3-948s1c1
Sequence:CCGGGTTTATCCAGATCGCTGTCATCTCGAGATGACAGCGATCTGGATAAACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080476.3-292s1c1
Sequence:CCGGGCAATCCAGGACTTCAATAAACTCGAGTTTATTGAAGTCCTGGATTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080476.3-876s1c1
Sequence:CCGGGTTTCAGATCAACGTCTTCTTCTCGAGAAGAAGACGTTGATCTGAAACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080476.4-433s21c1
Sequence:CCGGACTATGCTGAATTGGTGTTTACTCGAGTAAACACCAATTCAGCATAGTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080476.4-459s21c1
Sequence:CCGGACTGATGCACTCACTGCTATTCTCGAGAATAGCAGTGAGTGCATCAGTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080476.4-904s21c1
Sequence:CCGGGAAGCCTAGTGGTAATCATTTCTCGAGAAATGATTACCACTAGGCTTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080476.4-369s21c1
Sequence:CCGGCCGTATTCTGGAGCAGTATTTCTCGAGAAATACTGCTCCAGAATACGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004721
VALIDATED
PIGU MISSION shRNA Bacterial Glycerol Stock
phosphatidylinositol glycan anchor biosynthesis, class U
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000124971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001004721.1-942s1c1
Sequence:CCGGGCCATCAAATTAAAGGAGCATCTCGAGATGCTCCTTTAATTTGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001004721.1-1226s1c1
Sequence:CCGGCCTGCTCATCTCTGACTACTTCTCGAGAAGTAGTCAGAGATGAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001004721.1-450s1c1
Sequence:CCGGGCCCTGTTCTATCTCCTAAATCTCGAGATTTAGGAGATAGAACAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004721.1-657s21c1
Sequence:CCGGCGGCAGTACATCCCTGTTAAACTCGAGTTTAACAGGGATGTACTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124969    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004721.1-1426s1c1
Sequence:CCGGCCTCAGGCAGAAGAAGTTCAACTCGAGTTGAACTTCTTCTGCCTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001004721.1-657s1c1
Sequence:CCGGCGGCAGTACATCCCTGTTAAACTCGAGTTTAACAGGGATGTACTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004721.1-450s21c1
Sequence:CCGGGCCCTGTTCTATCTCCTAAATCTCGAGATTTAGGAGATAGAACAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309631    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001004721.1-1426s21c1
Sequence:CCGGCCTCAGGCAGAAGAAGTTCAACTCGAGTTGAACTTCTTCTGCCTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004721.1-942s21c1
Sequence:CCGGGCCATCAAATTAAAGGAGCATCTCGAGATGCTCCTTTAATTTGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004721.1-1226s21c1
Sequence:CCGGCCTGCTCATCTCTGACTACTTCTCGAGAAGTAGTCAGAGATGAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004721
VALIDATED
PIGU MISSION shRNA shRNA Plasmid DNA
phosphatidylinositol glycan anchor biosynthesis, class U
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000124971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001004721.1-942s1c1
Sequence:CCGGGCCATCAAATTAAAGGAGCATCTCGAGATGCTCCTTTAATTTGATGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000124973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001004721.1-1226s1c1
Sequence:CCGGCCTGCTCATCTCTGACTACTTCTCGAGAAGTAGTCAGAGATGAGCAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000124972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001004721.1-450s1c1
Sequence:CCGGGCCCTGTTCTATCTCCTAAATCTCGAGATTTAGGAGATAGAACAGGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000309565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004721.1-657s21c1
Sequence:CCGGCGGCAGTACATCCCTGTTAAACTCGAGTTTAACAGGGATGTACTGCCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000124969    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004721.1-1426s1c1
Sequence:CCGGCCTCAGGCAGAAGAAGTTCAACTCGAGTTGAACTTCTTCTGCCTGAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000124970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001004721.1-657s1c1
Sequence:CCGGCGGCAGTACATCCCTGTTAAACTCGAGTTTAACAGGGATGTACTGCCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000309566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004721.1-450s21c1
Sequence:CCGGGCCCTGTTCTATCTCCTAAATCTCGAGATTTAGGAGATAGAACAGGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000309631    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001004721.1-1426s21c1
Sequence:CCGGCCTCAGGCAGAAGAAGTTCAACTCGAGTTGAACTTCTTCTGCCTGAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000331961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004721.1-942s21c1
Sequence:CCGGGCCATCAAATTAAAGGAGCATCTCGAGATGCTCCTTTAATTTGATGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000331960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004721.1-1226s21c1
Sequence:CCGGCCTGCTCATCTCTGACTACTTCTCGAGAAGTAGTCAGAGATGAGCAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004721
VALIDATED
PIGU MISSION shRNA Lentiviral Transduction Particles
phosphatidylinositol glycan anchor biosynthesis, class U
Mouse
10 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000124971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001004721.1-942s1c1
Sequence:CCGGGCCATCAAATTAAAGGAGCATCTCGAGATGCTCCTTTAATTTGATGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001004721.1-1226s1c1
Sequence:CCGGCCTGCTCATCTCTGACTACTTCTCGAGAAGTAGTCAGAGATGAGCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001004721.1-450s1c1
Sequence:CCGGGCCCTGTTCTATCTCCTAAATCTCGAGATTTAGGAGATAGAACAGGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004721.1-657s21c1
Sequence:CCGGCGGCAGTACATCCCTGTTAAACTCGAGTTTAACAGGGATGTACTGCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124969    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004721.1-1426s1c1
Sequence:CCGGCCTCAGGCAGAAGAAGTTCAACTCGAGTTGAACTTCTTCTGCCTGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001004721.1-657s1c1
Sequence:CCGGCGGCAGTACATCCCTGTTAAACTCGAGTTTAACAGGGATGTACTGCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004721.1-450s21c1
Sequence:CCGGGCCCTGTTCTATCTCCTAAATCTCGAGATTTAGGAGATAGAACAGGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309631    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001004721.1-1426s21c1
Sequence:CCGGCCTCAGGCAGAAGAAGTTCAACTCGAGTTGAACTTCTTCTGCCTGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004721.1-942s21c1
Sequence:CCGGGCCATCAAATTAAAGGAGCATCTCGAGATGCTCCTTTAATTTGATGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004721.1-1226s21c1
Sequence:CCGGCCTGCTCATCTCTGACTACTTCTCGAGAAGTAGTCAGAGATGAGCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)