EMAIL THIS PAGE TO A FRIEND

PIGX

phosphatidylinositol glycan anchor biosynthesis, class X

82 Gene Product Result for
Synonyms: PIG-X
UniProtKB ID: Q8TBF5, Q9NWZ2
Gene ID:
Human(54965) Summary: This gene encodes a type I transmembrane protein in the endoplasmic reticulum (ER). The protein is an essential component of glycosylphosphatidylinositol-mannosyltransferase I, which transfers the first of the four mannoses in the GPI-anchor precursors during GPI-anchor biosynthesis. Studies in rat indicate that the protein is translated from a non-AUG translation initiation site. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
Mouse(72084) phosphatidylinositol glycan anchor biosynthesis, class X
Rat(288041) phosphatidylinositol glycan anchor biosynthesis, class X
Zebrafish(570443) phosphatidylinositol glycan anchor biosynthesis, class X
domestic cat(101087680) phosphatidylinositol glycan anchor biosynthesis, class X
dog(478602) phosphatidylinositol glycan anchor biosynthesis, class X
chicken(424859) phosphatidylinositol glycan anchor biosynthesis, class X
naked mole-rat(101706286) phosphatidylinositol glycan anchor biosynthesis, class X
domestic guinea pig(100722379) phosphatidylinositol glycan anchor biosynthesis, class X
cow(100298680) phosphatidylinositol glycan anchor biosynthesis, class X
sheep(101123438) phosphatidylinositol glycan anchor biosynthesis, class X
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024464 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024464 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024464 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017861 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017861 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017861 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017861 Rosetta Predictions human pricing
NM_001100651 Rosetta Predictions rat pricing
NM_001111025 Rosetta Predictions mouse pricing
NM_024464 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017861 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00069262 predicted 406
2 SASI_Hs01_00069264 predicted 883
3 SASI_Hs01_00069265 predicted 969
4 SASI_Hs01_00069266 predicted 950
5 SASI_Hs02_00350776 predicted 822
6 SASI_Hs01_00069267 predicted 832
7 SASI_Hs01_00069268 predicted 430
8 SASI_Hs01_00069269 predicted 955
9 SASI_Hs02_00350777 predicted 766
10 SASI_Hs01_00069270 predicted 383
11 SASI_Hs01_00069263 predicted 323
12 SASI_Hs01_00069271 predicted 932
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100651 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00210198 predicted 660
2 SASI_Rn02_00210199 predicted 631
3 SASI_Rn02_00210200 predicted 584
4 SASI_Rn02_00210201 predicted 415
5 SASI_Rn02_00210202 predicted 257
6 SASI_Rn02_00210203 predicted 583
7 SASI_Rn02_00210204 predicted 504
8 SASI_Rn02_00210205 predicted 567
9 SASI_Rn02_00210206 predicted 570
10 SASI_Rn02_00210207 predicted 391
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111025 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00306098 predicted 616
2 SASI_Mm02_00306099 predicted 508
3 SASI_Mm02_00306100 predicted 733
4 SASI_Mm02_00306101 predicted 582
5 SASI_Mm02_00306102 predicted 651
6 SASI_Mm02_00306103 predicted 748
7 SASI_Mm02_00306104 predicted 644
8 SASI_Mm02_00306105 predicted 496
9 SASI_Mm02_00306106 predicted 538
10 SASI_Mm02_00306107 predicted 582
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024464 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00082157 predicted 626
2 SASI_Mm01_00082158 predicted 506
3 SASI_Mm01_00082159 predicted 731
4 SASI_Mm01_00082162 predicted 592
5 SASI_Mm02_00327827 predicted 657
6 SASI_Mm01_00082163 predicted 757
7 SASI_Mm01_00082164 predicted 647
8 SASI_Mm02_00327828 predicted 496
9 SASI_Mm02_00327829 predicted 543
10 SASI_Mm02_00327830 predicted 592
11 SASI_Mm01_00082155 predicted 652
12 SASI_Mm01_00082156 predicted 596
13 SASI_Mm01_00082160 predicted 742
14 SASI_Mm01_00082161 predicted 674
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024464
VALIDATED
PIGX MISSION shRNA Bacterial Glycerol Stock
phosphatidylinositol glycan anchor biosynthesis, class X
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000337713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024464.3-267s21c1
Sequence:CCGGGCCACTTGTTCTGAAATTATTCTCGAGAATAATTTCAGAACAAGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024464.3-370s21c1
Sequence:CCGGAGACCTGCCGGCTCCTAATTACTCGAGTAATTAGGAGCCGGCAGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024464.2-517s1c1
Sequence:CCGGCAATGAATCTGCAGTCCTCATCTCGAGATGAGGACTGCAGATTCATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024464.2-619s1c1
Sequence:CCGGGAAAGATGGAGACACCCTCATCTCGAGATGAGGGTGTCTCCATCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024464.3-767s21c1
Sequence:CCGGGCAGTACAAATCAATACTTAACTCGAGTTAAGTATTGATTTGTACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024464.3-596s21c1
Sequence:CCGGTCGCTATCACCGGCCACATAACTCGAGTTATGTGGCCGGTGATAGCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024464.2-608s1c1
Sequence:CCGGCGGCCACATAAGAAAGATGGACTCGAGTCCATCTTTCTTATGTGGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024464.3-431s21c1
Sequence:CCGGGTTGGCTTCACTACGAGAAAGCTCGAGCTTTCTCGTAGTGAAGCCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024464.2-653s1c1
Sequence:CCGGCCCGACTTACTGATGTACTGTCTCGAGACAGTACATCAGTAAGTCGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024464
VALIDATED
PIGX MISSION shRNA shRNA Plasmid DNA
phosphatidylinositol glycan anchor biosynthesis, class X
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000337713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024464.3-267s21c1
Sequence:CCGGGCCACTTGTTCTGAAATTATTCTCGAGAATAATTTCAGAACAAGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024464.3-370s21c1
Sequence:CCGGAGACCTGCCGGCTCCTAATTACTCGAGTAATTAGGAGCCGGCAGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024464.2-517s1c1
Sequence:CCGGCAATGAATCTGCAGTCCTCATCTCGAGATGAGGACTGCAGATTCATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000202332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024464.2-619s1c1
Sequence:CCGGGAAAGATGGAGACACCCTCATCTCGAGATGAGGGTGTCTCCATCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024464.3-767s21c1
Sequence:CCGGGCAGTACAAATCAATACTTAACTCGAGTTAAGTATTGATTTGTACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024464.3-596s21c1
Sequence:CCGGTCGCTATCACCGGCCACATAACTCGAGTTATGTGGCCGGTGATAGCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024464.2-608s1c1
Sequence:CCGGCGGCCACATAAGAAAGATGGACTCGAGTCCATCTTTCTTATGTGGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024464.3-431s21c1
Sequence:CCGGGTTGGCTTCACTACGAGAAAGCTCGAGCTTTCTCGTAGTGAAGCCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024464.2-653s1c1
Sequence:CCGGCCCGACTTACTGATGTACTGTCTCGAGACAGTACATCAGTAAGTCGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024464
VALIDATED
PIGX MISSION shRNA Lentiviral Transduction Particles
phosphatidylinositol glycan anchor biosynthesis, class X
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000337713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024464.3-267s21c1
Sequence:CCGGGCCACTTGTTCTGAAATTATTCTCGAGAATAATTTCAGAACAAGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024464.3-370s21c1
Sequence:CCGGAGACCTGCCGGCTCCTAATTACTCGAGTAATTAGGAGCCGGCAGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024464.2-517s1c1
Sequence:CCGGCAATGAATCTGCAGTCCTCATCTCGAGATGAGGACTGCAGATTCATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024464.2-619s1c1
Sequence:CCGGGAAAGATGGAGACACCCTCATCTCGAGATGAGGGTGTCTCCATCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024464.3-767s21c1
Sequence:CCGGGCAGTACAAATCAATACTTAACTCGAGTTAAGTATTGATTTGTACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024464.3-596s21c1
Sequence:CCGGTCGCTATCACCGGCCACATAACTCGAGTTATGTGGCCGGTGATAGCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024464.2-608s1c1
Sequence:CCGGCGGCCACATAAGAAAGATGGACTCGAGTCCATCTTTCTTATGTGGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024464.3-431s21c1
Sequence:CCGGGTTGGCTTCACTACGAGAAAGCTCGAGCTTTCTCGTAGTGAAGCCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024464.2-653s1c1
Sequence:CCGGCCCGACTTACTGATGTACTGTCTCGAGACAGTACATCAGTAAGTCGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017861
VALIDATED
PIGX MISSION shRNA Bacterial Glycerol Stock
phosphatidylinositol glycan anchor biosynthesis, class X
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000140403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017861.1-252s1c1
Sequence:CCGGGATGGTTTCCACAGAGACCTTCTCGAGAAGGTCTCTGTGGAAACCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017861.1-759s1c1
Sequence:CCGGCTGACTGTACATACCTCTCTACTCGAGTAGAGAGGTATGTACAGTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017861.1-320s1c1
Sequence:CCGGCCGTCTCTTAATTAAACAGGACTCGAGTCCTGTTTAATTAAGAGACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017861.1-561s1c1
Sequence:CCGGGAAGATGGAGAAGCCTCGATTCTCGAGAATCGAGGCTTCTCCATCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413227    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017861.3-953s21c1
Sequence:CCGGTGCTTCCTAGAAACCTAAATACTCGAGTATTTAGGTTTCTAGGAAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017861.1-570s1c1
Sequence:CCGGGAAGCCTCGATTGTGGTCAATCTCGAGATTGACCACAATCGAGGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017861.1-485s1c1
Sequence:CCGGCAGACGAGATTCACAGTGCATCTCGAGATGCACTGTGAATCTCGTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017861.1-366s1c1
Sequence:CCGGCCGTATGAGTTGGCTTCATTACTCGAGTAATGAAGCCAACTCATACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428803    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017861.3-996s21c1
Sequence:CCGGAGGTGTTCTTCTAGAATTAATCTCGAGATTAATTCTAGAAGAACACCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017861
VALIDATED
PIGX MISSION shRNA shRNA Plasmid DNA
phosphatidylinositol glycan anchor biosynthesis, class X
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000140403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017861.1-252s1c1
Sequence:CCGGGATGGTTTCCACAGAGACCTTCTCGAGAAGGTCTCTGTGGAAACCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017861.1-759s1c1
Sequence:CCGGCTGACTGTACATACCTCTCTACTCGAGTAGAGAGGTATGTACAGTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017861.1-320s1c1
Sequence:CCGGCCGTCTCTTAATTAAACAGGACTCGAGTCCTGTTTAATTAAGAGACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017861.1-561s1c1
Sequence:CCGGGAAGATGGAGAAGCCTCGATTCTCGAGAATCGAGGCTTCTCCATCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413227    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017861.3-953s21c1
Sequence:CCGGTGCTTCCTAGAAACCTAAATACTCGAGTATTTAGGTTTCTAGGAAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017861.1-570s1c1
Sequence:CCGGGAAGCCTCGATTGTGGTCAATCTCGAGATTGACCACAATCGAGGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017861.1-485s1c1
Sequence:CCGGCAGACGAGATTCACAGTGCATCTCGAGATGCACTGTGAATCTCGTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017861.1-366s1c1
Sequence:CCGGCCGTATGAGTTGGCTTCATTACTCGAGTAATGAAGCCAACTCATACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428803    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017861.3-996s21c1
Sequence:CCGGAGGTGTTCTTCTAGAATTAATCTCGAGATTAATTCTAGAAGAACACCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017861
VALIDATED
PIGX MISSION shRNA Lentiviral Transduction Particles
phosphatidylinositol glycan anchor biosynthesis, class X
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000140403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017861.1-252s1c1
Sequence:CCGGGATGGTTTCCACAGAGACCTTCTCGAGAAGGTCTCTGTGGAAACCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017861.1-759s1c1
Sequence:CCGGCTGACTGTACATACCTCTCTACTCGAGTAGAGAGGTATGTACAGTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017861.1-320s1c1
Sequence:CCGGCCGTCTCTTAATTAAACAGGACTCGAGTCCTGTTTAATTAAGAGACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017861.1-561s1c1
Sequence:CCGGGAAGATGGAGAAGCCTCGATTCTCGAGAATCGAGGCTTCTCCATCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413227    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017861.3-953s21c1
Sequence:CCGGTGCTTCCTAGAAACCTAAATACTCGAGTATTTAGGTTTCTAGGAAGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017861.1-570s1c1
Sequence:CCGGGAAGCCTCGATTGTGGTCAATCTCGAGATTGACCACAATCGAGGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017861.1-485s1c1
Sequence:CCGGCAGACGAGATTCACAGTGCATCTCGAGATGCACTGTGAATCTCGTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017861.1-366s1c1
Sequence:CCGGCCGTATGAGTTGGCTTCATTACTCGAGTAATGAAGCCAACTCATACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428803    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017861.3-996s21c1
Sequence:CCGGAGGTGTTCTTCTAGAATTAATCTCGAGATTAATTCTAGAAGAACACCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)