EMAIL THIS PAGE TO A FRIEND

PIGZ

phosphatidylinositol glycan anchor biosynthesis, class Z

46 Gene Product Result for
Synonyms: GPI-MT-IV PIG-Z SMP3
UniProtKB ID: Q86VD9, Q9H9G6
Gene ID:
Human(80235) Summary: The glycosylphosphatidylinositol (GPI) anchor is a glycolipid found on many blood cells that serves to anchor proteins to the cell surface. This gene encodes a protein that is localized to the endoplasmic reticulum, and is involved in GPI anchor biosynthesis. As shown for the yeast homolog, which is a member of a family of dolichol-phosphate-mannose (Dol-P-Man)-dependent mannosyltransferases, this protein can also add a side-branching fourth mannose to GPI precursors during the assembly of GPI anchors. [provided by RefSeq, Jul 2008]
Mouse(239827) phosphatidylinositol glycan anchor biosynthesis, class Z
Rat(689116) phosphatidylinositol glycan anchor biosynthesis, class Z
sheep(101101862) phosphatidylinositol glycan anchor biosynthesis, class Z
naked mole-rat(101714762) phosphatidylinositol glycan anchor biosynthesis, class Z
Domestic Rabbit(100347329) phosphatidylinositol glycan anchor biosynthesis, class Z
domestic guinea pig(100722104) phosphatidylinositol glycan anchor biosynthesis, class Z
chicken(429144) phosphatidylinositol glycan anchor biosynthesis, class Z
domestic cat(101088427) phosphatidylinositol glycan anchor biosynthesis, class Z
Horse(100069661) phosphatidylinositol glycan anchor biosynthesis, class Z
dog(488034) phosphatidylinositol glycan anchor biosynthesis, class Z
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025163 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025163 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025163 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172822 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172822 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172822 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU030351 MISSION® esiRNA esiRNA human PIGZ (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025163 Rosetta Predictions human pricing
NM_001109525 Rosetta Predictions rat pricing
NM_172822 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025163 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00030892 predicted 1653
2 SASI_Hs01_00030893 predicted 215
3 SASI_Hs01_00030895 predicted 715
4 SASI_Hs01_00030896 predicted 881
5 SASI_Hs01_00030897 predicted 1510
6 SASI_Hs01_00030898 predicted 1384
7 SASI_Hs01_00030899 predicted 954
8 SASI_Hs01_00030900 predicted 320
9 SASI_Hs02_00357919 predicted 623
10 SASI_Hs01_00030901 predicted 990
11 SASI_Hs01_00030894 predicted 1087
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109525 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00249259 predicted 325
2 SASI_Rn02_00249260 predicted 885
3 SASI_Rn02_00249261 predicted 652
4 SASI_Rn02_00249262 predicted 786
5 SASI_Rn02_00249263 predicted 721
6 SASI_Rn02_00249264 predicted 956
7 SASI_Rn02_00249265 predicted 921
8 SASI_Rn02_00249266 predicted 374
9 SASI_Rn02_00249267 predicted 282
10 SASI_Rn02_00249268 predicted 573
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172822 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00141569 predicted 1769
2 SASI_Mm01_00141570 predicted 706
3 SASI_Mm02_00344748 predicted 383
4 SASI_Mm01_00141571 predicted 1390
5 SASI_Mm01_00141572 predicted 1296
6 SASI_Mm01_00141573 predicted 1771
7 SASI_Mm01_00141574 predicted 558
8 SASI_Mm01_00141575 predicted 705
9 SASI_Mm01_00141577 predicted 790
10 SASI_Mm01_00141578 predicted 1227
11 SASI_Mm01_00141576 predicted 243
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025163
PIGZ MISSION shRNA Bacterial Glycerol Stock
phosphatidylinositol glycan anchor biosynthesis, class Z
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437782    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025163.2-1910s21c1
Sequence:CCGGCCCAAGACTCAGCCATAGAAGCTCGAGCTTCTATGGCTGAGTCTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025163.2-1034s21c1
Sequence:CCGGTCTTGCACTACAACCTGAATCCTCGAGGATTCAGGTTGTAGTGCAAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025163.2-1756s1c1
Sequence:CCGGCCCTTCAAGAATGAAACACTTCTCGAGAAGTGTTTCATTCTTGAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025163.2-185s1c1
Sequence:CCGGCTGGGACATCATTCCAGGTTTCTCGAGAAACCTGGAATGATGTCCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025163.2-716s1c1
Sequence:CCGGTGCTGGTATCCTCCCATGTAACTCGAGTTACATGGGAGGATACCAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025163.2-994s1c1
Sequence:CCGGCCCGCTACATCCAGGAACCTTCTCGAGAAGGTTCCTGGATGTAGCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025163
PIGZ MISSION shRNA shRNA Plasmid DNA
phosphatidylinositol glycan anchor biosynthesis, class Z
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437782    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025163.2-1910s21c1
Sequence:CCGGCCCAAGACTCAGCCATAGAAGCTCGAGCTTCTATGGCTGAGTCTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025163.2-1034s21c1
Sequence:CCGGTCTTGCACTACAACCTGAATCCTCGAGGATTCAGGTTGTAGTGCAAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025163.2-1756s1c1
Sequence:CCGGCCCTTCAAGAATGAAACACTTCTCGAGAAGTGTTTCATTCTTGAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025163.2-185s1c1
Sequence:CCGGCTGGGACATCATTCCAGGTTTCTCGAGAAACCTGGAATGATGTCCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025163.2-716s1c1
Sequence:CCGGTGCTGGTATCCTCCCATGTAACTCGAGTTACATGGGAGGATACCAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025163.2-994s1c1
Sequence:CCGGCCCGCTACATCCAGGAACCTTCTCGAGAAGGTTCCTGGATGTAGCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025163
PIGZ MISSION shRNA Lentiviral Transduction Particles
phosphatidylinositol glycan anchor biosynthesis, class Z
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437782    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025163.2-1910s21c1
Sequence:CCGGCCCAAGACTCAGCCATAGAAGCTCGAGCTTCTATGGCTGAGTCTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025163.2-1034s21c1
Sequence:CCGGTCTTGCACTACAACCTGAATCCTCGAGGATTCAGGTTGTAGTGCAAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025163.2-1756s1c1
Sequence:CCGGCCCTTCAAGAATGAAACACTTCTCGAGAAGTGTTTCATTCTTGAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025163.2-185s1c1
Sequence:CCGGCTGGGACATCATTCCAGGTTTCTCGAGAAACCTGGAATGATGTCCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025163.2-716s1c1
Sequence:CCGGTGCTGGTATCCTCCCATGTAACTCGAGTTACATGGGAGGATACCAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025163.2-994s1c1
Sequence:CCGGCCCGCTACATCCAGGAACCTTCTCGAGAAGGTTCCTGGATGTAGCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172822
PIGZ MISSION shRNA Bacterial Glycerol Stock
phosphatidylinositol glycan anchor biosynthesis, class Z
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172822.1-239s1c1
Sequence:CCGGGCTACATACACCCAGATGAATCTCGAGATTCATCTGGGTGTATGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172822.1-1692s1c1
Sequence:CCGGCAAGAATGAGACTCTCTTGTTCTCGAGAACAAGAGAGTCTCATTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172822.1-1573s1c1
Sequence:CCGGCTGGACAACTTCAGCAGACAACTCGAGTTGTCTGCTGAAGTTGTCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172822.1-1231s1c1
Sequence:CCGGAGCCATCAAGAGGCTAGATTTCTCGAGAAATCTAGCCTCTTGATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172822.1-1688s1c1
Sequence:CCGGCCCTCAAGAATGAGACTCTCTCTCGAGAGAGAGTCTCATTCTTGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172822
PIGZ MISSION shRNA shRNA Plasmid DNA
phosphatidylinositol glycan anchor biosynthesis, class Z
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172822.1-239s1c1
Sequence:CCGGGCTACATACACCCAGATGAATCTCGAGATTCATCTGGGTGTATGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172822.1-1692s1c1
Sequence:CCGGCAAGAATGAGACTCTCTTGTTCTCGAGAACAAGAGAGTCTCATTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172822.1-1573s1c1
Sequence:CCGGCTGGACAACTTCAGCAGACAACTCGAGTTGTCTGCTGAAGTTGTCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172822.1-1231s1c1
Sequence:CCGGAGCCATCAAGAGGCTAGATTTCTCGAGAAATCTAGCCTCTTGATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172822.1-1688s1c1
Sequence:CCGGCCCTCAAGAATGAGACTCTCTCTCGAGAGAGAGTCTCATTCTTGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172822
PIGZ MISSION shRNA Lentiviral Transduction Particles
phosphatidylinositol glycan anchor biosynthesis, class Z
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172822.1-239s1c1
Sequence:CCGGGCTACATACACCCAGATGAATCTCGAGATTCATCTGGGTGTATGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172822.1-1692s1c1
Sequence:CCGGCAAGAATGAGACTCTCTTGTTCTCGAGAACAAGAGAGTCTCATTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172822.1-1573s1c1
Sequence:CCGGCTGGACAACTTCAGCAGACAACTCGAGTTGTCTGCTGAAGTTGTCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172822.1-1231s1c1
Sequence:CCGGAGCCATCAAGAGGCTAGATTTCTCGAGAAATCTAGCCTCTTGATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172822.1-1688s1c1
Sequence:CCGGCCCTCAAGAATGAGACTCTCTCTCGAGAGAGAGTCTCATTCTTGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)