EMAIL THIS PAGE TO A FRIEND

PIH1D1

PIH1 domain containing 1

58 Gene Product Result for
Synonyms: NOP17
UniProtKB ID: Q9NWS0, B4DGN7, B4E2X7, Q9BVL0
Gene ID:
Mouse(68845) PIH1 domain containing 1
Rat(292898) PIH1 domain containing 1
Zebrafish(553260) PIH1 domain containing 1
domestic cat(101097192) PIH1 domain containing 1
dog(611943) PIH1 domain containing 1
domestic guinea pig(100727926) PIH1 domain containing 1
naked mole-rat(101700158) PIH1 domain containing 1
cow(509212) PIH1 domain containing 1
sheep(101105844) PIH1 domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1412130 ANTI-FLJ20643 antibody produced in mouse clone 1E6, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1412131 ANTI-FLJ20643 antibody produced in mouse clone M2, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1412134 ANTI-FLJ20643 antibody produced in mouse clone M1, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1407605 Anti-PIH1D1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB1401738 Anti-PIH1D1 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA047258 Anti-PIH1D1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
WH0055011M2 Monoclonal Anti-FLJ20643 antibody produced in mouse clone 4H7, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1405137 Monoclonal Anti-FLJ20643 antibody produced in mouse clone 1G6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1409475 Monoclonal Anti-FLJ20643 antibody produced in mouse clone 4F5-1E10, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunoprecipitation (IP), western blot pricing
SAB1409476 Monoclonal Anti-FLJ20643 antibody produced in mouse clone 1E8, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017916 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017916 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017916 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029406 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029406 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029406 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017916 Rosetta Predictions human pricing
NM_001024868 Rosetta Predictions rat pricing
NM_029406 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017916 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00047620 predicted 708
2 SASI_Hs01_00047621 predicted 712
3 SASI_Hs01_00047622 predicted 354
4 SASI_Hs02_00350903 predicted 681
5 SASI_Hs01_00047624 predicted 599
6 SASI_Hs01_00047626 predicted 590
7 SASI_Hs01_00047627 predicted 280
8 SASI_Hs01_00047628 predicted 624
9 SASI_Hs01_00047629 predicted 836
10 SASI_Hs02_00350904 predicted 735
11 SASI_Hs01_00047623 predicted 626
12 SASI_Hs01_00047625 predicted 413
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024868 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00057781 predicted 401
2 SASI_Rn02_00202745 predicted 696
3 SASI_Rn01_00057783 predicted 777
4 SASI_Rn01_00057784 predicted 643
5 SASI_Rn01_00057785 predicted 678
6 SASI_Rn02_00202746 predicted 673
7 SASI_Rn01_00057786 predicted 681
8 SASI_Rn01_00057787 predicted 342
9 SASI_Rn01_00057788 predicted 676
10 SASI_Rn01_00057790 predicted 349
11 SASI_Rn01_00057782 predicted 738
12 SASI_Rn01_00057789 predicted 951
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029406 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00335302 predicted 803
2 SASI_Mm01_00054248 predicted 511
3 SASI_Mm01_00054249 predicted 594
4 SASI_Mm01_00054250 predicted 255
5 SASI_Mm01_00054252 predicted 766
6 SASI_Mm01_00054253 predicted 840
7 SASI_Mm01_00054254 predicted 603
8 SASI_Mm01_00054255 predicted 501
9 SASI_Mm01_00054256 predicted 488
10 SASI_Mm01_00054257 predicted 497
11 SASI_Mm01_00054251 predicted 866
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017916
VALIDATED
PIH1D1 MISSION shRNA Bacterial Glycerol Stock
PIH1 domain containing 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000242628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017916.1-678s21c1
Sequence:CCGGGAGGGCCTTGAGGACAAATACCTCGAGGTATTTGTCCTCAAGGCCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017916.1-701s21c1
Sequence:CCGGCTTGCAGCTGAATCCGGAATGCTCGAGCATTCCGGATTCAGCTGCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017916.1-992s21c1
Sequence:CCGGGTATCATCTAGACGCTTATATCTCGAGATATAAGCGTCTAGATGATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017916.1-350s21c1
Sequence:CCGGCCAGACAACCAGACCAGAATCCTCGAGGATTCTGGTCTGGTTGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017916.1-626s21c1
Sequence:CCGGGAGGATGCAGAACAGCGATTTCTCGAGAAATCGCTGTTCTGCATCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017916.1-358s1c1
Sequence:CCGGCCAGACCAGAATCGACACAAACTCGAGTTTGTGTCGATTCTGGTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017916.1-629s1c1
Sequence:CCGGGATGCAGAACAGCGATTTCTTCTCGAGAAGAAATCGCTGTTCTGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017916.1-728s1c1
Sequence:CCGGGATGAAGAACCGGCCATTCATCTCGAGATGAATGGCCGGTTCTTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017916
VALIDATED
PIH1D1 MISSION shRNA shRNA Plasmid DNA
PIH1 domain containing 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000242628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017916.1-678s21c1
Sequence:CCGGGAGGGCCTTGAGGACAAATACCTCGAGGTATTTGTCCTCAAGGCCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017916.1-701s21c1
Sequence:CCGGCTTGCAGCTGAATCCGGAATGCTCGAGCATTCCGGATTCAGCTGCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017916.1-992s21c1
Sequence:CCGGGTATCATCTAGACGCTTATATCTCGAGATATAAGCGTCTAGATGATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017916.1-350s21c1
Sequence:CCGGCCAGACAACCAGACCAGAATCCTCGAGGATTCTGGTCTGGTTGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017916.1-626s21c1
Sequence:CCGGGAGGATGCAGAACAGCGATTTCTCGAGAAATCGCTGTTCTGCATCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017916.1-358s1c1
Sequence:CCGGCCAGACCAGAATCGACACAAACTCGAGTTTGTGTCGATTCTGGTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017916.1-629s1c1
Sequence:CCGGGATGCAGAACAGCGATTTCTTCTCGAGAAGAAATCGCTGTTCTGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017916.1-728s1c1
Sequence:CCGGGATGAAGAACCGGCCATTCATCTCGAGATGAATGGCCGGTTCTTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017916
VALIDATED
PIH1D1 MISSION shRNA Lentiviral Transduction Particles
PIH1 domain containing 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000242628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017916.1-678s21c1
Sequence:CCGGGAGGGCCTTGAGGACAAATACCTCGAGGTATTTGTCCTCAAGGCCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017916.1-701s21c1
Sequence:CCGGCTTGCAGCTGAATCCGGAATGCTCGAGCATTCCGGATTCAGCTGCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017916.1-992s21c1
Sequence:CCGGGTATCATCTAGACGCTTATATCTCGAGATATAAGCGTCTAGATGATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017916.1-350s21c1
Sequence:CCGGCCAGACAACCAGACCAGAATCCTCGAGGATTCTGGTCTGGTTGTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017916.1-626s21c1
Sequence:CCGGGAGGATGCAGAACAGCGATTTCTCGAGAAATCGCTGTTCTGCATCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017916.1-358s1c1
Sequence:CCGGCCAGACCAGAATCGACACAAACTCGAGTTTGTGTCGATTCTGGTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017916.1-629s1c1
Sequence:CCGGGATGCAGAACAGCGATTTCTTCTCGAGAAGAAATCGCTGTTCTGCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017916.1-728s1c1
Sequence:CCGGGATGAAGAACCGGCCATTCATCTCGAGATGAATGGCCGGTTCTTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029406
VALIDATED
PIH1D1 MISSION shRNA Bacterial Glycerol Stock
PIH1 domain containing 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000195949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029406.1-511s1c1
Sequence:CCGGCGTCGCTGTCAATAGCAACTTCTCGAGAAGTTGCTATTGACAGCGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029406.1-319s1c1
Sequence:CCGGGACCAACTCATCGGAAGGAAACTCGAGTTTCCTTCCGATGAGTTGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029406.1-596s1c1
Sequence:CCGGCTTGAGGACAAGTATGGCCTACTCGAGTAGGCCATACTTGTCCTCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029406.1-812s1c1
Sequence:CCGGGCTGAAGTTGACCTTCCTAAACTCGAGTTTAGGAAGGTCAACTTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029406
VALIDATED
PIH1D1 MISSION shRNA shRNA Plasmid DNA
PIH1 domain containing 1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000195949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029406.1-511s1c1
Sequence:CCGGCGTCGCTGTCAATAGCAACTTCTCGAGAAGTTGCTATTGACAGCGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029406.1-319s1c1
Sequence:CCGGGACCAACTCATCGGAAGGAAACTCGAGTTTCCTTCCGATGAGTTGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029406.1-596s1c1
Sequence:CCGGCTTGAGGACAAGTATGGCCTACTCGAGTAGGCCATACTTGTCCTCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029406.1-812s1c1
Sequence:CCGGGCTGAAGTTGACCTTCCTAAACTCGAGTTTAGGAAGGTCAACTTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029406
VALIDATED
PIH1D1 MISSION shRNA Lentiviral Transduction Particles
PIH1 domain containing 1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000195949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029406.1-511s1c1
Sequence:CCGGCGTCGCTGTCAATAGCAACTTCTCGAGAAGTTGCTATTGACAGCGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029406.1-319s1c1
Sequence:CCGGGACCAACTCATCGGAAGGAAACTCGAGTTTCCTTCCGATGAGTTGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029406.1-596s1c1
Sequence:CCGGCTTGAGGACAAGTATGGCCTACTCGAGTAGGCCATACTTGTCCTCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029406.1-812s1c1
Sequence:CCGGGCTGAAGTTGACCTTCCTAAACTCGAGTTTAGGAAGGTCAACTTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)