EMAIL THIS PAGE TO A FRIEND

PIH1D2

PIH1 domain containing 2

78 Gene Product Result for
UniProtKB ID: Q8WWB5
Gene ID:
Mouse(72614) PIH1 domain containing 2
Rat(315645) PIH1 domain containing 2
cow(539917) PIH1 domain containing 2
sheep(101110702) PIH1 domain containing 2
naked mole-rat(101699257) PIH1 domain containing 2
domestic guinea pig(100716653) PIH1 domain containing 2
Zebrafish(494086) PIH1 domain containing 2
domestic cat(101094535) PIH1 domain containing 2
dog(479440) PIH1 domain containing 2
chicken(419795) PIH1 domain containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028300 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028300 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028300 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_138789 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138789 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138789 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001082619 Rosetta Predictions human pricing
NM_138789 Rosetta Predictions human pricing
XM_001067688 Rosetta Predictions rat pricing
XM_236221 Rosetta Predictions rat pricing
NM_028300 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001082619 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00316752 predicted 289
2 SASI_Hs02_00316753 predicted 247
3 SASI_Hs02_00316754 predicted 286
4 SASI_Hs02_00316755 predicted 793
5 SASI_Hs02_00316756 predicted 798
6 SASI_Hs02_00316757 predicted 366
7 SASI_Hs02_00316758 predicted 272
8 SASI_Hs02_00316759 predicted 239
9 SASI_Hs02_00316760 predicted 238
10 SASI_Hs02_00316761 predicted 301
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138789 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00363923 predicted 289
2 SASI_Hs02_00363924 predicted 245
3 SASI_Hs02_00363925 predicted 285
4 SASI_Hs02_00363926 predicted 802
5 SASI_Hs01_00112441 predicted 796
6 SASI_Hs02_00363927 predicted 359
7 SASI_Hs02_00363928 predicted 268
8 SASI_Hs02_00363929 predicted 241
9 SASI_Hs02_00363930 predicted 244
10 SASI_Hs02_00363931 predicted 299
11 SASI_Hs01_00112433 predicted 664
12 SASI_Hs01_00112434 predicted 793
13 SASI_Hs01_00112435 predicted 634
14 SASI_Hs01_00112436 predicted 663
15 SASI_Hs01_00112437 predicted 668
16 SASI_Hs01_00112438 predicted 612
17 SASI_Hs01_00112439 predicted 789
18 SASI_Hs01_00112440 predicted 815
19 SASI_Hs01_00112442 predicted 699
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067688 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00321845 predicted 608
2 SASI_Rn02_00321846 predicted 670
3 SASI_Rn02_00321847 predicted 602
4 SASI_Rn02_00321848 predicted 499
5 SASI_Rn02_00321849 predicted 998
6 SASI_Rn02_00321850 predicted 951
7 SASI_Rn02_00321851 predicted 545
8 SASI_Rn02_00321852 predicted 738
9 SASI_Rn02_00321853 predicted 394
10 SASI_Rn02_00321854 predicted 919
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_236221 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00389884 predicted 606
2 SASI_Rn02_00389885 predicted 665
3 SASI_Rn02_00389886 predicted 607
4 SASI_Rn02_00389887 predicted 497
5 SASI_Rn02_00389888 predicted 995
6 SASI_Rn02_00389889 predicted 951
7 SASI_Rn02_00389890 predicted 542
8 SASI_Rn02_00389891 predicted 736
9 SASI_Rn02_00389892 predicted 388
10 SASI_Rn02_00389893 predicted 925
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028300 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00192236 predicted 726
2 SASI_Mm01_00192237 predicted 926
3 SASI_Mm01_00192238 predicted 876
4 SASI_Mm02_00333648 predicted 378
5 SASI_Mm01_00192239 predicted 659
6 SASI_Mm01_00192243 predicted 413
7 SASI_Mm01_00192244 predicted 987
8 SASI_Mm01_00192245 predicted 347
9 SASI_Mm02_00333649 predicted 302
10 SASI_Mm02_00333650 predicted 797
11 SASI_Mm01_00192240 predicted 544
12 SASI_Mm01_00192241 predicted 329
13 SASI_Mm01_00192242 predicted 866
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028300
PIH1D2 MISSION shRNA Bacterial Glycerol Stock
PIH1 domain containing 2
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028300.2-1139s21c1
Sequence:CCGGCTCTGAGATGTACCGATTATGCTCGAGCATAATCGGTACATCTCAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028300.1-785s1c1
Sequence:CCGGGAAAGTCTGATGGGCATTAAACTCGAGTTTAATGCCCATCAGACTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028300.2-1107s21c1
Sequence:CCGGAGTGTTTCTGAGGTTGATATACTCGAGTATATCAACCTCAGAAACACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028300.1-557s1c1
Sequence:CCGGGTAAGTGTTGGCAGACCAGAACTCGAGTTCTGGTCTGCCAACACTTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028300.1-1013s1c1
Sequence:CCGGGTAAAGGATCGGAACGAGAAACTCGAGTTTCTCGTTCCGATCCTTTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028300.1-454s1c1
Sequence:CCGGCATACAGACCAAGATCCTAAACTCGAGTTTAGGATCTTGGTCTGTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028300.1-585s1c1
Sequence:CCGGCTGAGGCATCAGATGCTTATACTCGAGTATAAGCATCTGATGCCTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028300.1-996s1c1
Sequence:CCGGCGTACGAATTAAAGGTTGTAACTCGAGTTACAACCTTTAATTCGTACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028300.1-728s1c1
Sequence:CCGGGCACATTCCTACCATTTAACTCTCGAGAGTTAAATGGTAGGAATGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028300.1-929s1c1
Sequence:CCGGGCCAAAGGACGATGTCTTATACTCGAGTATAAGACATCGTCCTTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028300.2-1163s21c1
Sequence:CCGGGAATCTTCCAGAATCGATTAACTCGAGTTAATCGATTCTGGAAGATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028300.2-1221s21c1
Sequence:CCGGTCTGCATTAATCATTACAATGCTCGAGCATTGTAATGATTAATGCAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028300
PIH1D2 MISSION shRNA shRNA Plasmid DNA
PIH1 domain containing 2
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028300.2-1139s21c1
Sequence:CCGGCTCTGAGATGTACCGATTATGCTCGAGCATAATCGGTACATCTCAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028300.1-785s1c1
Sequence:CCGGGAAAGTCTGATGGGCATTAAACTCGAGTTTAATGCCCATCAGACTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028300.2-1107s21c1
Sequence:CCGGAGTGTTTCTGAGGTTGATATACTCGAGTATATCAACCTCAGAAACACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028300.1-557s1c1
Sequence:CCGGGTAAGTGTTGGCAGACCAGAACTCGAGTTCTGGTCTGCCAACACTTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028300.1-1013s1c1
Sequence:CCGGGTAAAGGATCGGAACGAGAAACTCGAGTTTCTCGTTCCGATCCTTTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028300.1-454s1c1
Sequence:CCGGCATACAGACCAAGATCCTAAACTCGAGTTTAGGATCTTGGTCTGTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028300.1-585s1c1
Sequence:CCGGCTGAGGCATCAGATGCTTATACTCGAGTATAAGCATCTGATGCCTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028300.1-996s1c1
Sequence:CCGGCGTACGAATTAAAGGTTGTAACTCGAGTTACAACCTTTAATTCGTACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028300.1-728s1c1
Sequence:CCGGGCACATTCCTACCATTTAACTCTCGAGAGTTAAATGGTAGGAATGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028300.1-929s1c1
Sequence:CCGGGCCAAAGGACGATGTCTTATACTCGAGTATAAGACATCGTCCTTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028300.2-1163s21c1
Sequence:CCGGGAATCTTCCAGAATCGATTAACTCGAGTTAATCGATTCTGGAAGATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028300.2-1221s21c1
Sequence:CCGGTCTGCATTAATCATTACAATGCTCGAGCATTGTAATGATTAATGCAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028300
PIH1D2 MISSION shRNA Lentiviral Transduction Particles
PIH1 domain containing 2
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028300.2-1139s21c1
Sequence:CCGGCTCTGAGATGTACCGATTATGCTCGAGCATAATCGGTACATCTCAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028300.1-785s1c1
Sequence:CCGGGAAAGTCTGATGGGCATTAAACTCGAGTTTAATGCCCATCAGACTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028300.2-1107s21c1
Sequence:CCGGAGTGTTTCTGAGGTTGATATACTCGAGTATATCAACCTCAGAAACACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028300.1-557s1c1
Sequence:CCGGGTAAGTGTTGGCAGACCAGAACTCGAGTTCTGGTCTGCCAACACTTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028300.1-1013s1c1
Sequence:CCGGGTAAAGGATCGGAACGAGAAACTCGAGTTTCTCGTTCCGATCCTTTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028300.1-454s1c1
Sequence:CCGGCATACAGACCAAGATCCTAAACTCGAGTTTAGGATCTTGGTCTGTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028300.1-585s1c1
Sequence:CCGGCTGAGGCATCAGATGCTTATACTCGAGTATAAGCATCTGATGCCTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028300.1-996s1c1
Sequence:CCGGCGTACGAATTAAAGGTTGTAACTCGAGTTACAACCTTTAATTCGTACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028300.1-728s1c1
Sequence:CCGGGCACATTCCTACCATTTAACTCTCGAGAGTTAAATGGTAGGAATGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028300.1-929s1c1
Sequence:CCGGGCCAAAGGACGATGTCTTATACTCGAGTATAAGACATCGTCCTTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028300.2-1163s21c1
Sequence:CCGGGAATCTTCCAGAATCGATTAACTCGAGTTAATCGATTCTGGAAGATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028300.2-1221s21c1
Sequence:CCGGTCTGCATTAATCATTACAATGCTCGAGCATTGTAATGATTAATGCAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138789
PIH1D2 MISSION shRNA Bacterial Glycerol Stock
PIH1 domain containing 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000417588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138789.3-785s21c1
Sequence:CCGGCAGATACGAAGCAGTACTATGCTCGAGCATAGTACTGCTTCGTATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138789.3-304s21c1
Sequence:CCGGTGAGGGCTATGAGAAGTTTATCTCGAGATAAACTTCTCATAGCCCTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138789.2-309s1c1
Sequence:CCGGCCAGAAGATACAACTGAGATACTCGAGTATCTCAGTTGTATCTTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138789.2-333s1c1
Sequence:CCGGGATGCTTACACAGTCATTGATCTCGAGATCAATGACTGTGTAAGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138789.2-357s1c1
Sequence:CCGGGCCTACAATCCTGATGTTCTTCTCGAGAAGAACATCAGGATTGTAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138789.2-288s1c1
Sequence:CCGGGTACCTCTAACTGTTGGCAAACTCGAGTTTGCCAACAGTTAGAGGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138789.2-687s1c1
Sequence:CCGGGAAGAGATTTCCAGTACTGAACTCGAGTTCAGTACTGGAAATCTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138789
PIH1D2 MISSION shRNA shRNA Plasmid DNA
PIH1 domain containing 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000417588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138789.3-785s21c1
Sequence:CCGGCAGATACGAAGCAGTACTATGCTCGAGCATAGTACTGCTTCGTATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138789.3-304s21c1
Sequence:CCGGTGAGGGCTATGAGAAGTTTATCTCGAGATAAACTTCTCATAGCCCTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138789.2-309s1c1
Sequence:CCGGCCAGAAGATACAACTGAGATACTCGAGTATCTCAGTTGTATCTTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138789.2-333s1c1
Sequence:CCGGGATGCTTACACAGTCATTGATCTCGAGATCAATGACTGTGTAAGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138789.2-357s1c1
Sequence:CCGGGCCTACAATCCTGATGTTCTTCTCGAGAAGAACATCAGGATTGTAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138789.2-288s1c1
Sequence:CCGGGTACCTCTAACTGTTGGCAAACTCGAGTTTGCCAACAGTTAGAGGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138789.2-687s1c1
Sequence:CCGGGAAGAGATTTCCAGTACTGAACTCGAGTTCAGTACTGGAAATCTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138789
PIH1D2 MISSION shRNA Lentiviral Transduction Particles
PIH1 domain containing 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000417588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138789.3-785s21c1
Sequence:CCGGCAGATACGAAGCAGTACTATGCTCGAGCATAGTACTGCTTCGTATCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138789.3-304s21c1
Sequence:CCGGTGAGGGCTATGAGAAGTTTATCTCGAGATAAACTTCTCATAGCCCTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138789.2-309s1c1
Sequence:CCGGCCAGAAGATACAACTGAGATACTCGAGTATCTCAGTTGTATCTTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138789.2-333s1c1
Sequence:CCGGGATGCTTACACAGTCATTGATCTCGAGATCAATGACTGTGTAAGCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138789.2-357s1c1
Sequence:CCGGGCCTACAATCCTGATGTTCTTCTCGAGAAGAACATCAGGATTGTAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138789.2-288s1c1
Sequence:CCGGGTACCTCTAACTGTTGGCAAACTCGAGTTTGCCAACAGTTAGAGGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138789.2-687s1c1
Sequence:CCGGGAAGAGATTTCCAGTACTGAACTCGAGTTCAGTACTGGAAATCTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)