EMAIL THIS PAGE TO A FRIEND

PIK3AP1

phosphoinositide-3-kinase adaptor protein 1

116 Gene Product Result for
Synonyms: BCAP RP11-34E5.3
UniProtKB ID: Q6ZUJ8, Q5TB56, Q5VXJ9, Q8N6J6, Q8NAC8
Gene ID:
Mouse(83490) phosphoinositide-3-kinase adaptor protein 1
Rat(294048) phosphoinositide-3-kinase adaptor protein 1
Zebrafish(100002256) phosphoinositide-3-kinase adaptor protein 1
chicken(374268) phosphoinositide-3-kinase adaptor protein 1
dog(608653) phosphoinositide-3-kinase adaptor protein 1
domestic cat(101086927) phosphoinositide-3-kinase adaptor protein 1
Horse(100070796) phosphoinositide-3-kinase adaptor protein 1
cow(100138311) phosphoinositide-3-kinase adaptor protein 1
sheep(101112273) phosphoinositide-3-kinase adaptor protein 1
naked mole-rat(101720717) phosphoinositide-3-kinase adaptor protein 1
domestic guinea pig(100714359) phosphoinositide-3-kinase adaptor protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031376 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_031376 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_031376 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152309 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152309 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152309 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152309 Rosetta Predictions human pricing
NM_001106368 Rosetta Predictions rat pricing
NM_031376 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152309 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00136261 predicted 698
2 SASI_Hs02_00365893 predicted 840
3 SASI_Hs01_00136262 predicted 2033
4 SASI_Hs02_00365894 predicted 2558
5 SASI_Hs01_00136263 predicted 1102
6 SASI_Hs01_00136264 predicted 705
7 SASI_Hs01_00136266 predicted 2384
8 SASI_Hs01_00136267 predicted 1767
9 SASI_Hs01_00136268 predicted 1485
10 SASI_Hs01_00136269 predicted 798
11 SASI_Hs01_00136260 predicted 1572
12 SASI_Hs01_00136265 predicted 2641
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106368 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00218278 predicted 1548
2 SASI_Rn02_00218279 predicted 912
3 SASI_Rn02_00218280 predicted 1062
4 SASI_Rn02_00218281 predicted 1173
5 SASI_Rn02_00218282 predicted 910
6 SASI_Rn02_00218283 predicted 2394
7 SASI_Rn02_00218284 predicted 894
8 SASI_Rn02_00218285 predicted 1371
9 SASI_Rn02_00218286 predicted 1619
10 SASI_Rn02_00218287 predicted 704
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031376 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00049092 predicted 866
2 SASI_Mm01_00049093 predicted 1737
3 SASI_Mm01_00049094 predicted 1384
4 SASI_Mm01_00049095 predicted 1563
5 SASI_Mm01_00049096 predicted 1459
6 SASI_Mm01_00049097 predicted 1798
7 SASI_Mm01_00049098 predicted 1074
8 SASI_Mm02_00337118 predicted 725
9 SASI_Mm02_00337119 predicted 1798
10 SASI_Mm01_00049101 predicted 672
11 SASI_Mm01_00049099 predicted 219
12 SASI_Mm01_00049100 predicted 2650
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031376
PIK3AP1 MISSION shRNA Bacterial Glycerol Stock
phosphoinositide-3-kinase adaptor protein 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000364218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031376.3-2333s21c1
Sequence:CCGGCGACAACGAGGACAACGAAATCTCGAGATTTCGTTGTCCTCGTTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031376.3-1549s21c1
Sequence:CCGGACTCGATGATCCGCAAGTTTCCTCGAGGAAACTTGCGGATCATCGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031376.3-1872s21c1
Sequence:CCGGTCGAGCATCTACGACCCATTTCTCGAGAAATGGGTCGTAGATGCTCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031376.1-1538s1c1
Sequence:CCGGGCCCACTAAAGACTCGATGATCTCGAGATCATCGAGTCTTTAGTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031376.3-873s21c1
Sequence:CCGGGAAACCACCGTCAGCTATTATCTCGAGATAATAGCTGACGGTGGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031376.1-1743s1c1
Sequence:CCGGCCTGACAATGAGCCATACATTCTCGAGAATGTATGGCTCATTGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031376.1-880s1c1
Sequence:CCGGCCGTCAGCTATTATACCGACACTCGAGTGTCGGTATAATAGCTGACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031376.1-1464s1c1
Sequence:CCGGGCCACAGAAGACCTCTATGTTCTCGAGAACATAGAGGTCTTCTGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031376.1-881s1c1
Sequence:CCGGCGTCAGCTATTATACCGACATCTCGAGATGTCGGTATAATAGCTGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031376
PIK3AP1 MISSION shRNA shRNA Plasmid DNA
phosphoinositide-3-kinase adaptor protein 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000364218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031376.3-2333s21c1
Sequence:CCGGCGACAACGAGGACAACGAAATCTCGAGATTTCGTTGTCCTCGTTGTCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000364219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031376.3-1549s21c1
Sequence:CCGGACTCGATGATCCGCAAGTTTCCTCGAGGAAACTTGCGGATCATCGAGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000364221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031376.3-1872s21c1
Sequence:CCGGTCGAGCATCTACGACCCATTTCTCGAGAAATGGGTCGTAGATGCTCGATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000088630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031376.1-1538s1c1
Sequence:CCGGGCCCACTAAAGACTCGATGATCTCGAGATCATCGAGTCTTTAGTGGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000364220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031376.3-873s21c1
Sequence:CCGGGAAACCACCGTCAGCTATTATCTCGAGATAATAGCTGACGGTGGTTTCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000088628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031376.1-1743s1c1
Sequence:CCGGCCTGACAATGAGCCATACATTCTCGAGAATGTATGGCTCATTGTCAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000088632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031376.1-880s1c1
Sequence:CCGGCCGTCAGCTATTATACCGACACTCGAGTGTCGGTATAATAGCTGACGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000088631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031376.1-1464s1c1
Sequence:CCGGGCCACAGAAGACCTCTATGTTCTCGAGAACATAGAGGTCTTCTGTGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000088629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031376.1-881s1c1
Sequence:CCGGCGTCAGCTATTATACCGACATCTCGAGATGTCGGTATAATAGCTGACGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031376
PIK3AP1 MISSION shRNA Lentiviral Transduction Particles
phosphoinositide-3-kinase adaptor protein 1
Mouse
9 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000364218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031376.3-2333s21c1
Sequence:CCGGCGACAACGAGGACAACGAAATCTCGAGATTTCGTTGTCCTCGTTGTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031376.3-1549s21c1
Sequence:CCGGACTCGATGATCCGCAAGTTTCCTCGAGGAAACTTGCGGATCATCGAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031376.3-1872s21c1
Sequence:CCGGTCGAGCATCTACGACCCATTTCTCGAGAAATGGGTCGTAGATGCTCGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031376.1-1538s1c1
Sequence:CCGGGCCCACTAAAGACTCGATGATCTCGAGATCATCGAGTCTTTAGTGGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031376.3-873s21c1
Sequence:CCGGGAAACCACCGTCAGCTATTATCTCGAGATAATAGCTGACGGTGGTTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031376.1-1743s1c1
Sequence:CCGGCCTGACAATGAGCCATACATTCTCGAGAATGTATGGCTCATTGTCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031376.1-880s1c1
Sequence:CCGGCCGTCAGCTATTATACCGACACTCGAGTGTCGGTATAATAGCTGACGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031376.1-1464s1c1
Sequence:CCGGGCCACAGAAGACCTCTATGTTCTCGAGAACATAGAGGTCTTCTGTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031376.1-881s1c1
Sequence:CCGGCGTCAGCTATTATACCGACATCTCGAGATGTCGGTATAATAGCTGACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152309
VALIDATED
PIK3AP1 MISSION shRNA Bacterial Glycerol Stock
phosphoinositide-3-kinase adaptor protein 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000195077    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152309.2-2655s1c1
Sequence:CCGGCCATTCTCATTGCTGATAATGCTCGAGCATTATCAGCAATGAGAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152309.2-1400s1c1
Sequence:CCGGCCTTTCCACAGACCTGCTTATCTCGAGATAAGCAGGTCTGTGGAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152309.2-1898s1c1
Sequence:CCGGGTCGAGTATATATGACCCTTTCTCGAGAAAGGGTCATATATACTCGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_152309.2-769s1c1
Sequence:CCGGCTGAGGATTCTCCCTCTGTAACTCGAGTTACAGAGGGAGAATCCTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152309.2-1770s1c1
Sequence:CCGGCCTGACAACGAACCATACATTCTCGAGAATGTATGGTTCGTTGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_152309.2-1028s1c1
Sequence:CCGGGCTAACCGAATCCCTGAAGAACTCGAGTTCTTCAGGGATTCGGTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_152309.2-1415s1c1
Sequence:CCGGGCTTATGAAATGCTCGCTCAACTCGAGTTGAGCGAGCATTTCATAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152309.2-2366s1c1
Sequence:CCGGCGAGGATAATGAAGTCCCTGACTCGAGTCAGGGACTTCATTATCCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152309
VALIDATED
PIK3AP1 MISSION shRNA shRNA Plasmid DNA
phosphoinositide-3-kinase adaptor protein 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000195077    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152309.2-2655s1c1
Sequence:CCGGCCATTCTCATTGCTGATAATGCTCGAGCATTATCAGCAATGAGAATGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000195351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152309.2-1400s1c1
Sequence:CCGGCCTTTCCACAGACCTGCTTATCTCGAGATAAGCAGGTCTGTGGAAAGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000196557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152309.2-1898s1c1
Sequence:CCGGGTCGAGTATATATGACCCTTTCTCGAGAAAGGGTCATATATACTCGACTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000033297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_152309.2-769s1c1
Sequence:CCGGCTGAGGATTCTCCCTCTGTAACTCGAGTTACAGAGGGAGAATCCTCAGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000033295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152309.2-1770s1c1
Sequence:CCGGCCTGACAACGAACCATACATTCTCGAGAATGTATGGTTCGTTGTCAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000033296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_152309.2-1028s1c1
Sequence:CCGGGCTAACCGAATCCCTGAAGAACTCGAGTTCTTCAGGGATTCGGTTAGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000033298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_152309.2-1415s1c1
Sequence:CCGGGCTTATGAAATGCTCGCTCAACTCGAGTTGAGCGAGCATTTCATAAGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000195494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152309.2-2366s1c1
Sequence:CCGGCGAGGATAATGAAGTCCCTGACTCGAGTCAGGGACTTCATTATCCTCGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152309
VALIDATED
PIK3AP1 MISSION shRNA Lentiviral Transduction Particles
phosphoinositide-3-kinase adaptor protein 1
Human
8 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000195077    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152309.2-2655s1c1
Sequence:CCGGCCATTCTCATTGCTGATAATGCTCGAGCATTATCAGCAATGAGAATGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152309.2-1400s1c1
Sequence:CCGGCCTTTCCACAGACCTGCTTATCTCGAGATAAGCAGGTCTGTGGAAAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152309.2-1898s1c1
Sequence:CCGGGTCGAGTATATATGACCCTTTCTCGAGAAAGGGTCATATATACTCGACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_152309.2-769s1c1
Sequence:CCGGCTGAGGATTCTCCCTCTGTAACTCGAGTTACAGAGGGAGAATCCTCAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152309.2-1770s1c1
Sequence:CCGGCCTGACAACGAACCATACATTCTCGAGAATGTATGGTTCGTTGTCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_152309.2-1028s1c1
Sequence:CCGGGCTAACCGAATCCCTGAAGAACTCGAGTTCTTCAGGGATTCGGTTAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_152309.2-1415s1c1
Sequence:CCGGGCTTATGAAATGCTCGCTCAACTCGAGTTGAGCGAGCATTTCATAAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152309.2-2366s1c1
Sequence:CCGGCGAGGATAATGAAGTCCCTGACTCGAGTCAGGGACTTCATTATCCTCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)