EMAIL THIS PAGE TO A FRIEND

PIK3C2A

phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 alpha

68 Gene Product Result for
Synonyms: CPK PI3-K-C2(ALPHA) PI3-K-C2A
UniProtKB ID: O00443, B0LPH2, Q14CQ9
Gene ID:
Human(5286) Summary: The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. The PI3-kinase activity of this protein is not sensitive to nanomolar levels of the inhibitor wortmanin. This protein was shown to be able to be activated by insulin and may be involved in integrin-dependent signaling. [provided by RefSeq, Jul 2008]
Mouse(18704) phosphatidylinositol 3-kinase, C2 domain containing, alpha polypeptide
Rat(361632) phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 alpha
domestic guinea pig(100722144) phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 alpha
naked mole-rat(101702206) phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 alpha
Domestic Rabbit(100340704) phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 alpha
cow(537790) phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 alpha
sheep(101114899) phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 alpha
Zebrafish(571356) phosphoinositide-3-kinase, class 2, alpha polypeptide
chicken(423070) phosphoinositide-3-kinase, class 2, alpha polypeptide
domestic cat(101096512) phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 alpha
Horse(100056431) phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 alpha
dog(485399) phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 alpha
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002645 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002645 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002645 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011083 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011083 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011083 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002645 Rosetta Predictions human pricing
NM_001108500 Rosetta Predictions rat pricing
NM_011083 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002645 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00233971 predicted 3210
2 SASI_Hs01_00233972 predicted 700
3 SASI_Hs01_00233973 predicted 2242
4 SASI_Hs01_00233974 predicted 1085
5 SASI_Hs01_00233975 predicted 2959
6 SASI_Hs01_00233976 predicted 3544
7 SASI_Hs01_00233977 predicted 3129
8 SASI_Hs01_00233978 predicted 279
9 SASI_Hs01_00233979 predicted 597
10 SASI_Hs01_00233980 predicted 3081
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108500 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00239259 predicted 4210
2 SASI_Rn02_00239260 predicted 823
3 SASI_Rn02_00239261 predicted 4651
4 SASI_Rn02_00239262 predicted 1722
5 SASI_Rn02_00239263 predicted 2360
6 SASI_Rn02_00239264 predicted 2006
7 SASI_Rn02_00239265 predicted 2459
8 SASI_Rn02_00239266 predicted 2788
9 SASI_Rn02_00239267 predicted 3305
10 SASI_Rn02_00239268 predicted 775
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011083 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00319855 predicted 1066
2 SASI_Mm02_00319856 predicted 4125
3 SASI_Mm02_00319857 predicted 4574
4 SASI_Mm02_00319858 predicted 1636
5 SASI_Mm02_00319859 predicted 3801
6 SASI_Mm02_00319860 predicted 2147
7 SASI_Mm02_00319861 predicted 3212
8 SASI_Mm02_00319862 predicted 3533
9 SASI_Mm02_00319863 predicted 2713
10 SASI_Mm02_00319864 predicted 2276
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002645
VALIDATED
PIK3C2A MISSION shRNA Bacterial Glycerol Stock
phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 alpha
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000002228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002645.x-449s1c1
Sequence:CCGGCCACTTATGCTTTACCTTCTACTCGAGTAGAAGGTAAAGCATAAGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002645.x-3226s1c1
Sequence:CCGGCAAAGAAGTATGGAACGAGTACTCGAGTACTCGTTCCATACTTCTTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_002645.x-1714s1c1
Sequence:CCGGCGAGCAGTAGATCAAGTAATTCTCGAGAATTACTTGATCTACTGCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002645.x-1264s1c1
Sequence:CCGGGCTAGTGTGAAGGTCTCCATTCTCGAGAATGGAGACCTTCACACTAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_002645.1-316s1c1
Sequence:CCGGGATGACAGTTTCGAGACTAAACTCGAGTTTAGTCTCGAAACTGTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_002645.1-2242s1c1
Sequence:CCGGCCTATCCAGATATCACAATTGCTCGAGCAATTGTGATATCTGGATAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_002645.x-4267s1c1
Sequence:CCGGCGAATCAAGGAAGTCTCTGTTCTCGAGAACAGAGACTTCCTTGATTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002645.1-4703s1c1
Sequence:CCGGCTTACCGAAATGGTACTCTTTCTCGAGAAAGAGTACCATTTCGGTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_002645.1-4593s1c1
Sequence:CCGGCCACCCTTTACTTCGTGATGACTCGAGTCATCACGAAGTAAAGGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_002645.1-1918s1c1
Sequence:CCGGCCTGTTCAAGTAAGCATAAACCTCGAGGTTTATGCTTACTTGAACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_002645.1-4857s1c1
Sequence:CCGGGAATCCGACATTCAATGAAATCTCGAGATTTCATTGAATGTCGGATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_002645.1-346s1c1
Sequence:CCGGGTATTACCAGTTACTCCTATTCTCGAGAATAGGAGTAACTGGTAATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_002645.1-3955s1c1
Sequence:CCGGGCCTACAACTTGATAAGAAAGCTCGAGCTTTCTTATCAAGTTGTAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_002645.1-2802s1c1
Sequence:CCGGGCCTGCATTGTACCCACTAATCTCGAGATTAGTGGGTACAATGCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002645
VALIDATED
PIK3C2A MISSION shRNA shRNA Plasmid DNA
phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 alpha
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000002228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002645.x-449s1c1
Sequence:CCGGCCACTTATGCTTTACCTTCTACTCGAGTAGAAGGTAAAGCATAAGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002645.x-3226s1c1
Sequence:CCGGCAAAGAAGTATGGAACGAGTACTCGAGTACTCGTTCCATACTTCTTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_002645.x-1714s1c1
Sequence:CCGGCGAGCAGTAGATCAAGTAATTCTCGAGAATTACTTGATCTACTGCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002645.x-1264s1c1
Sequence:CCGGGCTAGTGTGAAGGTCTCCATTCTCGAGAATGGAGACCTTCACACTAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_002645.1-316s1c1
Sequence:CCGGGATGACAGTTTCGAGACTAAACTCGAGTTTAGTCTCGAAACTGTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_002645.1-2242s1c1
Sequence:CCGGCCTATCCAGATATCACAATTGCTCGAGCAATTGTGATATCTGGATAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_002645.x-4267s1c1
Sequence:CCGGCGAATCAAGGAAGTCTCTGTTCTCGAGAACAGAGACTTCCTTGATTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002645.1-4703s1c1
Sequence:CCGGCTTACCGAAATGGTACTCTTTCTCGAGAAAGAGTACCATTTCGGTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_002645.1-4593s1c1
Sequence:CCGGCCACCCTTTACTTCGTGATGACTCGAGTCATCACGAAGTAAAGGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_002645.1-1918s1c1
Sequence:CCGGCCTGTTCAAGTAAGCATAAACCTCGAGGTTTATGCTTACTTGAACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_002645.1-4857s1c1
Sequence:CCGGGAATCCGACATTCAATGAAATCTCGAGATTTCATTGAATGTCGGATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_002645.1-346s1c1
Sequence:CCGGGTATTACCAGTTACTCCTATTCTCGAGAATAGGAGTAACTGGTAATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_002645.1-3955s1c1
Sequence:CCGGGCCTACAACTTGATAAGAAAGCTCGAGCTTTCTTATCAAGTTGTAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_002645.1-2802s1c1
Sequence:CCGGGCCTGCATTGTACCCACTAATCTCGAGATTAGTGGGTACAATGCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002645
VALIDATED
PIK3C2A MISSION shRNA Lentiviral Transduction Particles
phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 alpha
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000002228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002645.x-449s1c1
Sequence:CCGGCCACTTATGCTTTACCTTCTACTCGAGTAGAAGGTAAAGCATAAGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002645.x-3226s1c1
Sequence:CCGGCAAAGAAGTATGGAACGAGTACTCGAGTACTCGTTCCATACTTCTTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_002645.x-1714s1c1
Sequence:CCGGCGAGCAGTAGATCAAGTAATTCTCGAGAATTACTTGATCTACTGCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002645.x-1264s1c1
Sequence:CCGGGCTAGTGTGAAGGTCTCCATTCTCGAGAATGGAGACCTTCACACTAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_002645.1-316s1c1
Sequence:CCGGGATGACAGTTTCGAGACTAAACTCGAGTTTAGTCTCGAAACTGTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_002645.1-2242s1c1
Sequence:CCGGCCTATCCAGATATCACAATTGCTCGAGCAATTGTGATATCTGGATAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_002645.x-4267s1c1
Sequence:CCGGCGAATCAAGGAAGTCTCTGTTCTCGAGAACAGAGACTTCCTTGATTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002645.1-4703s1c1
Sequence:CCGGCTTACCGAAATGGTACTCTTTCTCGAGAAAGAGTACCATTTCGGTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_002645.1-4593s1c1
Sequence:CCGGCCACCCTTTACTTCGTGATGACTCGAGTCATCACGAAGTAAAGGGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_002645.1-1918s1c1
Sequence:CCGGCCTGTTCAAGTAAGCATAAACCTCGAGGTTTATGCTTACTTGAACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_002645.1-4857s1c1
Sequence:CCGGGAATCCGACATTCAATGAAATCTCGAGATTTCATTGAATGTCGGATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_002645.1-346s1c1
Sequence:CCGGGTATTACCAGTTACTCCTATTCTCGAGAATAGGAGTAACTGGTAATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_002645.1-3955s1c1
Sequence:CCGGGCCTACAACTTGATAAGAAAGCTCGAGCTTTCTTATCAAGTTGTAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_002645.1-2802s1c1
Sequence:CCGGGCCTGCATTGTACCCACTAATCTCGAGATTAGTGGGTACAATGCAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011083
VALIDATED
PIK3C2A MISSION shRNA Bacterial Glycerol Stock
phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 alpha
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000024889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011083.1-2962s1c1
Sequence:CCGGCGGCAAGATATGTTAGCTTTACTCGAGTAAAGCTAACATATCTTGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011083.1-2551s1c1
Sequence:CCGGGCACACAGTTTGTATTGGCTTCTCGAGAAGCCAATACAAACTGTGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011083.1-1191s1c1
Sequence:CCGGGCTCTTAGATTCCTATCACTACTCGAGTAGTGATAGGAATCTAAGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011083.1-938s1c1
Sequence:CCGGGCAGCTACATTCTGAAAGTTTCTCGAGAAACTTTCAGAATGTAGCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011083.1-2059s1c1
Sequence:CCGGCCTGCGTTTGACATTATTTATCTCGAGATAAATAATGTCAAACGCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011083.2-2155s21c1
Sequence:CCGGCACCTAACAACAGCGATTTATCTCGAGATAAATCGCTGTTGTTAGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350691    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011083.2-5696s21c1
Sequence:CCGGAGAACTACTAAGTCGTTTATACTCGAGTATAAACGACTTAGTAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011083.2-522s21c1
Sequence:CCGGGATATTGCTGGACGACAATTTCTCGAGAAATTGTCGTCCAGCAATATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011083.2-1622s21c1
Sequence:CCGGGCAGCTACATTCTGAAAGTTTCTCGAGAAACTTTCAGAATGTAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011083.2-2285s21c1
Sequence:CCGGTCTATGCCGCACACGGAATTTCTCGAGAAATTCCGTGTGCGGCATAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011083
VALIDATED
PIK3C2A MISSION shRNA shRNA Plasmid DNA
phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 alpha
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000024889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011083.1-2962s1c1
Sequence:CCGGCGGCAAGATATGTTAGCTTTACTCGAGTAAAGCTAACATATCTTGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011083.1-2551s1c1
Sequence:CCGGGCACACAGTTTGTATTGGCTTCTCGAGAAGCCAATACAAACTGTGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011083.1-1191s1c1
Sequence:CCGGGCTCTTAGATTCCTATCACTACTCGAGTAGTGATAGGAATCTAAGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011083.1-938s1c1
Sequence:CCGGGCAGCTACATTCTGAAAGTTTCTCGAGAAACTTTCAGAATGTAGCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011083.1-2059s1c1
Sequence:CCGGCCTGCGTTTGACATTATTTATCTCGAGATAAATAATGTCAAACGCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011083.2-2155s21c1
Sequence:CCGGCACCTAACAACAGCGATTTATCTCGAGATAAATCGCTGTTGTTAGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350691    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011083.2-5696s21c1
Sequence:CCGGAGAACTACTAAGTCGTTTATACTCGAGTATAAACGACTTAGTAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011083.2-522s21c1
Sequence:CCGGGATATTGCTGGACGACAATTTCTCGAGAAATTGTCGTCCAGCAATATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011083.2-1622s21c1
Sequence:CCGGGCAGCTACATTCTGAAAGTTTCTCGAGAAACTTTCAGAATGTAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011083.2-2285s21c1
Sequence:CCGGTCTATGCCGCACACGGAATTTCTCGAGAAATTCCGTGTGCGGCATAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011083
VALIDATED
PIK3C2A MISSION shRNA Lentiviral Transduction Particles
phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 alpha
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000024889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011083.1-2962s1c1
Sequence:CCGGCGGCAAGATATGTTAGCTTTACTCGAGTAAAGCTAACATATCTTGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011083.1-2551s1c1
Sequence:CCGGGCACACAGTTTGTATTGGCTTCTCGAGAAGCCAATACAAACTGTGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011083.1-1191s1c1
Sequence:CCGGGCTCTTAGATTCCTATCACTACTCGAGTAGTGATAGGAATCTAAGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011083.1-938s1c1
Sequence:CCGGGCAGCTACATTCTGAAAGTTTCTCGAGAAACTTTCAGAATGTAGCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011083.1-2059s1c1
Sequence:CCGGCCTGCGTTTGACATTATTTATCTCGAGATAAATAATGTCAAACGCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011083.2-2155s21c1
Sequence:CCGGCACCTAACAACAGCGATTTATCTCGAGATAAATCGCTGTTGTTAGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350691    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011083.2-5696s21c1
Sequence:CCGGAGAACTACTAAGTCGTTTATACTCGAGTATAAACGACTTAGTAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011083.2-522s21c1
Sequence:CCGGGATATTGCTGGACGACAATTTCTCGAGAAATTGTCGTCCAGCAATATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011083.2-1622s21c1
Sequence:CCGGGCAGCTACATTCTGAAAGTTTCTCGAGAAACTTTCAGAATGTAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011083.2-2285s21c1
Sequence:CCGGTCTATGCCGCACACGGAATTTCTCGAGAAATTCCGTGTGCGGCATAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)